Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   HPC60_RS12205 Genome accession   NZ_CP053671
Coordinates   2391900..2392196 (-) Length   98 a.a.
NCBI ID   WP_010906316.1    Uniprot ID   A0A3N6L9Y1
Organism   Lactococcus lactis subsp. lactis strain G121     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2386900..2397196
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HPC60_RS12170 (HPC60_06920) - 2387182..2388048 (+) 867 WP_025017140.1 RluA family pseudouridine synthase -
  HPC60_RS12175 (HPC60_06925) - 2388086..2388895 (-) 810 WP_014570791.1 metal ABC transporter permease -
  HPC60_RS12180 (HPC60_06930) - 2388888..2389625 (-) 738 WP_012898617.1 metal ABC transporter ATP-binding protein -
  HPC60_RS12185 (HPC60_06935) - 2389802..2390644 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  HPC60_RS12190 (HPC60_06940) - 2390641..2391078 (-) 438 WP_003129992.1 zinc-dependent MarR family transcriptional regulator -
  HPC60_RS12195 (HPC60_06945) comGG 2391168..2391452 (-) 285 WP_025017139.1 competence type IV pilus minor pilin ComGG Machinery gene
  HPC60_RS12200 (HPC60_06950) comGF 2391491..2391937 (-) 447 WP_029344525.1 competence type IV pilus minor pilin ComGF Machinery gene
  HPC60_RS12205 (HPC60_06955) comGE 2391900..2392196 (-) 297 WP_010906316.1 competence type IV pilus minor pilin ComGE Machinery gene
  HPC60_RS12210 (HPC60_06960) comGD 2392168..2392584 (-) 417 WP_025017137.1 competence type IV pilus minor pilin ComGD Machinery gene
  HPC60_RS12215 (HPC60_06965) comGC 2392559..2392882 (-) 324 WP_032943614.1 competence type IV pilus major pilin ComGC Machinery gene
  HPC60_RS12220 (HPC60_06970) comGB 2392956..2394029 (-) 1074 WP_074453836.1 competence type IV pilus assembly protein ComGB Machinery gene
  HPC60_RS12225 (HPC60_06975) comGA 2393923..2394861 (-) 939 WP_031561106.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11076.95 Da        Isoelectric Point: 6.4684

>NTDB_id=446216 HPC60_RS12205 WP_010906316.1 2391900..2392196(-) (comGE) [Lactococcus lactis subsp. lactis strain G121]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=446216 HPC60_RS12205 WP_010906316.1 2391900..2392196(-) (comGE) [Lactococcus lactis subsp. lactis strain G121]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

68.041

98.98

0.673