Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   HC660_RS12240 Genome accession   NZ_CP051464
Coordinates   2349676..2349849 (+) Length   57 a.a.
NCBI ID   WP_010334916.1    Uniprot ID   -
Organism   Bacillus mojavensis strain UCMB5075     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 2344676..2354849
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HC660_RS12225 (HC660_23370) gcvT 2345476..2346564 (-) 1089 WP_168748224.1 glycine cleavage system aminomethyltransferase GcvT -
  HC660_RS12230 (HC660_23380) - 2347008..2348681 (+) 1674 WP_168748225.1 SNF2-related protein -
  HC660_RS12235 (HC660_23390) - 2348702..2349496 (+) 795 WP_168748226.1 YqhG family protein -
  HC660_RS12240 (HC660_23400) sinI 2349676..2349849 (+) 174 WP_010334916.1 anti-repressor SinI family protein Regulator
  HC660_RS12245 (HC660_23410) sinR 2349883..2350218 (+) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  HC660_RS12250 (HC660_23420) tasA 2350306..2351091 (-) 786 WP_168748227.1 biofilm matrix protein TasA -
  HC660_RS12255 (HC660_23430) - 2351156..2351740 (-) 585 WP_168748228.1 signal peptidase I -
  HC660_RS12260 (HC660_23440) tapA 2351712..2352473 (-) 762 WP_168748229.1 amyloid fiber anchoring/assembly protein TapA -
  HC660_RS12265 (HC660_23450) - 2352750..2353073 (+) 324 WP_168748230.1 YqzG/YhdC family protein -
  HC660_RS12270 (HC660_23460) - 2353116..2353295 (-) 180 WP_003236949.1 YqzE family protein -
  HC660_RS12275 (HC660_23470) comGG 2353367..2353741 (-) 375 WP_168748231.1 competence type IV pilus minor pilin ComGG Machinery gene
  HC660_RS12280 (HC660_23480) comGF 2353742..2354125 (-) 384 WP_168748232.1 competence type IV pilus minor pilin ComGF Machinery gene
  HC660_RS12285 (HC660_23490) comGE 2354151..2354498 (-) 348 WP_168748233.1 competence type IV pilus minor pilin ComGE Machinery gene

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6687.63 Da        Isoelectric Point: 6.4604

>NTDB_id=438486 HC660_RS12240 WP_010334916.1 2349676..2349849(+) (sinI) [Bacillus mojavensis strain UCMB5075]
MKNAKQEHFELDQEWVELMMEAREANISPEEIRKYLLLNKKSAYPGPAARSHTVNPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=438486 HC660_RS12240 WP_010334916.1 2349676..2349849(+) (sinI) [Bacillus mojavensis strain UCMB5075]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTGGATCAAGAATGGGTTGAATTAATGATGGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTTATCCTGGTCCGGCAGCCAGAAGTCATACCG
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947