Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   HC660_RS02150 Genome accession   NZ_CP051464
Coordinates   428383..428505 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus mojavensis strain UCMB5075     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423383..433505
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  HC660_RS02135 (HC660_04170) yclJ 424988..425671 (+) 684 WP_010333020.1 two-component system response regulator YclJ -
  HC660_RS02140 (HC660_04180) - 425658..427073 (+) 1416 WP_168746929.1 HAMP domain-containing sensor histidine kinase -
  HC660_RS02145 (HC660_04190) rapC 427251..428399 (+) 1149 WP_168746930.1 response regulator aspartate phosphatase RapC Regulator
  HC660_RS02150 (HC660_04200) phrC 428383..428505 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  HC660_RS02155 - 428610..428702 (-) 93 WP_026014660.1 YjcZ family sporulation protein -
  HC660_RS02160 - 428788..428877 (-) 90 Protein_388 sporulation protein YjcZ -
  HC660_RS02165 (HC660_04210) - 428997..430361 (-) 1365 WP_168746931.1 aspartate kinase -
  HC660_RS02170 (HC660_04220) ceuB 430747..431697 (+) 951 WP_010333025.1 petrobactin ABC transporter permease YclN Machinery gene
  HC660_RS02175 (HC660_04230) yclO 431690..432637 (+) 948 WP_024120217.1 petrobactin ABC transporter permease YclO -
  HC660_RS02180 (HC660_04240) yclP 432631..433389 (+) 759 WP_168746932.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=438456 HC660_RS02150 WP_010333023.1 428383..428505(+) (phrC) [Bacillus mojavensis strain UCMB5075]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=438456 HC660_RS02150 WP_010333023.1 428383..428505(+) (phrC) [Bacillus mojavensis strain UCMB5075]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTCCATGTCACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9