Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   GYO_RS24480 Genome accession   NC_016047
Coordinates   546522..546644 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus spizizenii TU-B-10     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 541522..551644
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  GYO_RS24465 (GYO_0591) yclJ 543136..543819 (+) 684 WP_014112647.1 two-component system response regulator YclJ -
  GYO_RS24470 (GYO_0592) yclK 543806..545227 (+) 1422 WP_072565741.1 two-component system sensor histidine kinase YclK -
  GYO_RS24475 (GYO_0593) rapC 545390..546538 (+) 1149 WP_014112649.1 response regulator aspartate phosphatase RapC Regulator
  GYO_RS24480 (GYO_0594) phrC 546522..546644 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  GYO_RS24485 - 546743..546850 (-) 108 WP_041520857.1 YjcZ family sporulation protein -
  GYO_RS24490 (GYO_0595) - 547003..548367 (-) 1365 WP_014112650.1 aspartate kinase -
  GYO_RS24495 (GYO_0596) ceuB 548753..549703 (+) 951 WP_014112651.1 petrobactin ABC transporter permease YclN Machinery gene
  GYO_RS24500 (GYO_0597) yclO 549696..550643 (+) 948 WP_014112652.1 petrobactin ABC transporter permease YclO -
  GYO_RS24505 (GYO_0598) yclP 550637..551395 (+) 759 WP_014112653.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=42558 GYO_RS24480 WP_003224994.1 546522..546644(+) (phrC) [Bacillus spizizenii TU-B-10]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=42558 GYO_RS24480 WP_003224994.1 546522..546644(+) (phrC) [Bacillus spizizenii TU-B-10]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment