Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   FPL20_RS01205 Genome accession   NZ_CP045478
Coordinates   209198..209320 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain JD-014     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 204198..214320
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  FPL20_RS01175 (FPL20_GE00224) yclP 204269..205027 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  FPL20_RS01180 (FPL20_GE00225) yclO 205021..205968 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  FPL20_RS01185 (FPL20_GE00226) ceuB 205961..206911 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  FPL20_RS01190 (FPL20_GE00227) thrD 207296..208660 (+) 1365 WP_003234493.1 aspartate kinase -
  FPL20_RS01195 (FPL20_GE00228) yczN 208814..208927 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  FPL20_RS01200 yczM 209009..209098 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  FPL20_RS01205 (FPL20_GE00229) phrC 209198..209320 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  FPL20_RS01210 (FPL20_GE00230) rapC 209304..210452 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  FPL20_RS01215 (FPL20_GE00231) yclK 210615..212036 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  FPL20_RS01220 (FPL20_GE00232) yclJ 212023..212706 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=394453 FPL20_RS01205 WP_003224994.1 209198..209320(-) (phrC) [Bacillus subtilis strain JD-014]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=394453 FPL20_RS01205 WP_003224994.1 209198..209320(-) (phrC) [Bacillus subtilis strain JD-014]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment