Detailed information    

insolico Bioinformatically predicted

Overview

Name   comC/blpC   Type   Regulator
Locus tag   F5989_RS07765 Genome accession   NZ_CP044221
Coordinates   1561929..1562069 (-) Length   46 a.a.
NCBI ID   WP_002267610.1    Uniprot ID   Q99QI5
Organism   Streptococcus mutans strain NCH105     
Function   binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology)   
Competence regulation

Genomic Context

Location: 1556929..1567069
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  F5989_RS07745 (F5989_07885) - 1557929..1558555 (+) 627 WP_002266898.1 hypothetical protein -
  F5989_RS07750 (F5989_07890) - 1558603..1559241 (+) 639 WP_002262115.1 VTT domain-containing protein -
  F5989_RS07755 (F5989_07895) comE/blpR 1559713..1560465 (+) 753 WP_002262114.1 response regulator transcription factor Regulator
  F5989_RS07760 (F5989_07900) comD/blpH 1560462..1561787 (+) 1326 WP_002289696.1 sensor histidine kinase Regulator
  F5989_RS07765 (F5989_07905) comC/blpC 1561929..1562069 (-) 141 WP_002267610.1 ComC/BlpC family leader-containing pheromone/bacteriocin Regulator
  F5989_RS07770 (F5989_07910) cipB 1562336..1562566 (+) 231 WP_002265368.1 Blp family class II bacteriocin Regulator
  F5989_RS07775 (F5989_07915) - 1562697..1563098 (+) 402 WP_002310604.1 hypothetical protein -
  F5989_RS07785 (F5989_07925) - 1564479..1564898 (+) 420 WP_002263913.1 hypothetical protein -
  F5989_RS07790 (F5989_07930) - 1565045..1565449 (+) 405 WP_002263912.1 hypothetical protein -
  F5989_RS10295 - 1565572..1565784 (-) 213 Protein_1468 IS3 family transposase -
  F5989_RS07795 (F5989_07945) - 1566224..1566388 (+) 165 WP_002265308.1 hypothetical protein -
  F5989_RS07805 (F5989_07955) - 1566793..1567005 (+) 213 WP_002263744.1 Blp family class II bacteriocin -

Sequence

Protein


Download         Length: 46 a.a.        Molecular weight: 5211.06 Da        Isoelectric Point: 10.4929

>NTDB_id=388866 F5989_RS07765 WP_002267610.1 1561929..1562069(-) (comC/blpC) [Streptococcus mutans strain NCH105]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK

Nucleotide


Download         Length: 141 bp        

>NTDB_id=388866 F5989_RS07765 WP_002267610.1 1561929..1562069(-) (comC/blpC) [Streptococcus mutans strain NCH105]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA

Domains

Predicted by InterproScan.

COMC family (ComC)

(1-32)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  PDB 2I2J

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comC/blpC Streptococcus mutans UA159

100

100

1

Multiple sequence alignment