Detailed information    

insolico Bioinformatically predicted

Overview

Name   ssb   Type   Machinery gene
Locus tag   EGX75_RS02775 Genome accession   NZ_CP033787
Coordinates   555751..556224 (-) Length   157 a.a.
NCBI ID   WP_002358253.1    Uniprot ID   -
Organism   Enterococcus faecalis strain FDAARGOS_528     
Function   ssDNA binding (predicted from homology)   
DNA processing

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
ICE 499611..567400 555751..556224 within 0


Gene organization within MGE regions


Location: 499611..567400
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  EGX75_RS02490 (EGX75_02495) - 499876..500910 (-) 1035 WP_002404895.1 ammonium transporter -
  EGX75_RS02495 (EGX75_02500) - 501140..501544 (-) 405 WP_002358541.1 NusG domain II-containing protein -
  EGX75_RS02500 (EGX75_02505) - 501596..501973 (-) 378 WP_002382844.1 hypothetical protein -
  EGX75_RS02505 (EGX75_02510) rpmF 501995..502168 (-) 174 WP_002358539.1 50S ribosomal protein L32 -
  EGX75_RS02510 (EGX75_02515) - 502507..503562 (+) 1056 WP_033607432.1 YibE/F family protein -
  EGX75_RS02515 (EGX75_02520) - 503559..504323 (+) 765 WP_002358536.1 YibE/F family protein -
  EGX75_RS02520 (EGX75_02525) - 504956..505438 (-) 483 WP_002358535.1 PTS glucose transporter subunit IIA -
  EGX75_RS02525 (EGX75_02530) - 505449..506951 (-) 1503 WP_002358534.1 PTS transporter subunit EIIC -
  EGX75_RS02530 (EGX75_02535) - 506944..507651 (-) 708 WP_002358533.1 N-acetylmannosamine-6-phosphate 2-epimerase -
  EGX75_RS02535 (EGX75_02540) - 507807..508625 (+) 819 WP_002358531.1 MurR/RpiR family transcriptional regulator -
  EGX75_RS02540 (EGX75_02545) - 509081..509233 (-) 153 WP_229204429.1 hypothetical protein -
  EGX75_RS02545 (EGX75_02550) - 509372..509991 (-) 620 Protein_481 recombinase family protein -
  EGX75_RS02550 (EGX75_02555) - 510241..510799 (+) 559 Protein_482 recombinase family protein -
  EGX75_RS02555 (EGX75_02560) - 510845..511582 (-) 738 WP_002404677.1 hypothetical protein -
  EGX75_RS02560 (EGX75_02565) - 511570..511671 (+) 102 Protein_484 IS30 family transposase -
  EGX75_RS02565 (EGX75_02570) - 511811..512131 (-) 321 WP_174088396.1 hypothetical protein -
  EGX75_RS02570 (EGX75_02575) - 512356..513564 (-) 1209 WP_002358521.1 YSIRK-targeted surface antigen transcriptional regulator -
  EGX75_RS02575 (EGX75_02580) - 513763..519657 (-) 5895 WP_115252352.1 Rib/alpha-like domain-containing protein -
  EGX75_RS02580 (EGX75_02585) - 519933..520469 (-) 537 WP_002358518.1 Asp23/Gls24 family envelope stress response protein -
  EGX75_RS02585 (EGX75_02590) - 520498..520689 (-) 192 WP_002358517.1 DUF2273 domain-containing protein -
  EGX75_RS02590 (EGX75_02595) amaP 520706..521272 (-) 567 WP_010706722.1 alkaline shock response membrane anchor protein AmaP -
  EGX75_RS15265 - 521542..521829 (-) 288 WP_308525485.1 S41 family peptidase -
  EGX75_RS02595 (EGX75_02600) - 521843..522424 (-) 582 WP_002401490.1 hypothetical protein -
  EGX75_RS02600 (EGX75_02605) - 522502..522996 (-) 495 WP_002358512.1 hypothetical protein -
  EGX75_RS02605 (EGX75_02610) - 523433..523996 (-) 564 WP_002358511.1 hypothetical protein -
  EGX75_RS02610 (EGX75_02615) - 524247..526076 (-) 1830 WP_002358510.1 C47 family peptidase -
  EGX75_RS02615 (EGX75_02620) - 526089..526769 (-) 681 WP_002404658.1 hypothetical protein -
  EGX75_RS02620 (EGX75_02625) - 527234..527866 (-) 633 WP_002358507.1 hypothetical protein -
  EGX75_RS02625 - 528147..528329 (-) 183 WP_002358506.1 hypothetical protein -
  EGX75_RS15470 (EGX75_02635) - 528524..529230 (-) 707 Protein_499 winged helix-turn-helix domain-containing protein -
  EGX75_RS02640 (EGX75_02640) tnpA 529436..529891 (+) 456 WP_002358504.1 IS200/IS605 family transposase -
  EGX75_RS02645 (EGX75_02645) - 530078..531395 (-) 1318 Protein_501 Y-family DNA polymerase -
  EGX75_RS02650 (EGX75_02650) - 531511..531762 (-) 252 WP_002358502.1 hypothetical protein -
  EGX75_RS15405 (EGX75_02655) - 531855..531983 (+) 129 WP_010706728.1 hypothetical protein -
  EGX75_RS02660 (EGX75_02660) - 532036..532435 (+) 400 Protein_504 DDE-type integrase/transposase/recombinase -
  EGX75_RS02665 (EGX75_02665) - 532580..533605 (-) 1026 WP_002358496.1 hypothetical protein -
  EGX75_RS02670 (EGX75_02670) - 533889..534089 (-) 201 WP_002404680.1 hypothetical protein -
  EGX75_RS15410 - 534193..534315 (+) 123 WP_256332644.1 hypothetical protein -
  EGX75_RS02675 (EGX75_02675) - 534677..534844 (-) 168 WP_002358494.1 type II toxin-antitoxin system RelB/DinJ family antitoxin -
  EGX75_RS02680 (EGX75_02680) - 534889..535614 (-) 726 WP_002358492.1 hypothetical protein -
  EGX75_RS02685 (EGX75_02685) - 535757..536377 (-) 621 WP_002404683.1 recombinase family protein -
  EGX75_RS02690 (EGX75_02690) - 536477..537280 (-) 804 WP_002367820.1 AAA family ATPase -
  EGX75_RS02695 (EGX75_02695) - 537273..538700 (-) 1428 WP_002367821.1 Mu transposase C-terminal domain-containing protein -
  EGX75_RS02700 (EGX75_02700) - 538678..539262 (-) 585 WP_002367823.1 recombinase family protein -
  EGX75_RS02705 (EGX75_02705) - 539648..541690 (+) 2043 WP_002367824.1 histidinol-phosphatase -
  EGX75_RS02710 (EGX75_02710) - 541671..541973 (+) 303 WP_002367825.1 hypothetical protein -
  EGX75_RS02715 (EGX75_02715) - 542411..544060 (-) 1650 WP_229240806.1 DNA/RNA helicase domain-containing protein -
  EGX75_RS15280 (EGX75_02720) - 544602..545486 (-) 885 WP_229203480.1 site-2 protease family protein -
  EGX75_RS02725 (EGX75_02725) - 545586..546824 (-) 1239 WP_002404803.1 S8 family serine peptidase -
  EGX75_RS02730 (EGX75_02730) - 546821..548965 (-) 2145 WP_002358488.1 peptidase domain-containing ABC transporter -
  EGX75_RS02735 (EGX75_02735) - 548977..551958 (-) 2982 WP_002358487.1 type 2 lanthipeptide synthetase LanM family protein -
  EGX75_RS02740 (EGX75_02740) cylL-S 552019..552210 (-) 192 WP_002358181.1 lanthipeptide cytolysin subunit CylL-S -
  EGX75_RS02745 (EGX75_02745) cylL-L 552244..552450 (-) 207 WP_002358485.1 lanthipeptide cytolysin subunit CylL-L -
  EGX75_RS02755 (EGX75_02755) cylR2 552854..553054 (+) 201 WP_002358483.1 cytolysin regulator CylR2 -
  EGX75_RS02760 (EGX75_02760) - 553591..554820 (-) 1230 WP_002358481.1 hypothetical protein -
  EGX75_RS02765 (EGX75_02765) - 554914..555303 (-) 390 WP_010706731.1 hypothetical protein -
  EGX75_RS02770 (EGX75_02770) - 555296..555718 (-) 423 WP_002358479.1 hypothetical protein -
  EGX75_RS02775 (EGX75_02775) ssb 555751..556224 (-) 474 WP_002358253.1 single-stranded DNA-binding protein Machinery gene
  EGX75_RS02780 (EGX75_02780) - 556232..556378 (-) 147 WP_010706732.1 hypothetical protein -
  EGX75_RS02785 (EGX75_02785) - 556392..556805 (-) 414 WP_002358478.1 hypothetical protein -
  EGX75_RS02790 (EGX75_02790) - 556809..557144 (-) 336 WP_002358477.1 thioredoxin fold domain-containing protein -
  EGX75_RS02795 (EGX75_02795) - 557162..557551 (-) 390 WP_002358476.1 hypothetical protein -
  EGX75_RS02800 (EGX75_02800) - 557566..557832 (-) 267 WP_002358475.1 hypothetical protein -
  EGX75_RS02805 (EGX75_02805) - 557926..563139 (-) 5214 WP_002358474.1 helicase-related protein -
  EGX75_RS15285 - 563127..563972 (-) 846 WP_002358473.1 hypothetical protein -
  EGX75_RS02820 (EGX75_02820) - 563973..564686 (-) 714 WP_002358472.1 hypothetical protein -
  EGX75_RS02825 (EGX75_02825) - 564694..566274 (-) 1581 WP_002404807.1 DUF3991 domain-containing protein -
  EGX75_RS02830 (EGX75_02830) - 566341..566610 (-) 270 WP_002358470.1 type II toxin-antitoxin system RelE/ParE family toxin -
  EGX75_RS02835 (EGX75_02835) relB 566610..566837 (-) 228 WP_002413218.1 type II toxin-antitoxin system RelB family antitoxin -

Sequence

Protein


Download         Length: 157 a.a.        Molecular weight: 17491.36 Da        Isoelectric Point: 4.9225

>NTDB_id=325703 EGX75_RS02775 WP_002358253.1 555751..556224(-) (ssb) [Enterococcus faecalis strain FDAARGOS_528]
MINNVTLVGRLANDVDLRYTSSGIAVGQFRLAVNRNFTNQSGEREADFISCAIWRKAAESLANYARKGSLLGITGRIQTR
NYDNQQGQRVYVTEVIVENFQLLESKEISEQRRANASTPVTNGQQANNQQQTPLPDPLDPFSKESSPVNISDDDLPF

Nucleotide


Download         Length: 474 bp        

>NTDB_id=325703 EGX75_RS02775 WP_002358253.1 555751..556224(-) (ssb) [Enterococcus faecalis strain FDAARGOS_528]
ATGATTAATAATGTTACGTTAGTTGGGCGTTTAGCTAATGATGTGGATTTAAGGTATACATCAAGTGGGATTGCAGTTGG
ACAATTTCGTTTAGCAGTCAATCGGAATTTTACCAATCAATCTGGGGAGCGAGAAGCGGATTTTATTAGTTGTGCGATAT
GGCGCAAAGCGGCAGAATCGCTTGCTAATTACGCACGTAAAGGTAGCTTACTTGGAATTACTGGTCGTATTCAGACGCGA
AACTATGATAACCAGCAAGGACAACGTGTTTATGTGACAGAAGTGATTGTAGAAAATTTTCAATTGTTAGAATCCAAAGA
AATAAGCGAACAACGTCGGGCGAATGCTTCTACGCCTGTAACCAATGGGCAGCAGGCTAATAACCAACAACAGACACCAC
TTCCTGATCCGCTTGATCCTTTCTCAAAGGAGTCTAGCCCAGTAAATATTTCGGATGATGATTTGCCATTCTAA

Domains

Predicted by InterproScan.

Single-strand binding protein family (SSB)

(2-103)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  ssb Latilactobacillus sakei subsp. sakei 23K

57.059

100

0.618
  ssbA Bacillus subtilis subsp. subtilis str. 168

50.575

100

0.561
  ssbB Bacillus subtilis subsp. subtilis str. 168

56.604

67.516

0.382

Multiple sequence alignment