Detailed information
Overview
| Name | comYE | Type | Machinery gene |
| Locus tag | DK181_RS00930 | Genome accession | NZ_CP029490 |
| Coordinates | 156326..156619 (+) | Length | 97 a.a. |
| NCBI ID | WP_002959510.1 | Uniprot ID | - |
| Organism | Streptococcus sobrinus strain SL1 | ||
| Function | dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| ICE | 124667..171478 | 156326..156619 | within | 0 |
Gene organization within MGE regions
Location: 124667..171478
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DK181_RS00795 (DK182_00795) | rpoC | 127924..131562 (+) | 3639 | WP_019773487.1 | DNA-directed RNA polymerase subunit beta' | - |
| DK181_RS00800 (DK182_00800) | - | 131856..133520 (+) | 1665 | WP_028798551.1 | peptide ABC transporter substrate-binding protein | - |
| DK181_RS00805 (DK182_00805) | - | 133626..134540 (+) | 915 | WP_002960866.1 | ABC transporter permease | - |
| DK181_RS00810 (DK182_00810) | - | 134552..135583 (+) | 1032 | WP_002960868.1 | ABC transporter permease | - |
| DK181_RS00815 (DK182_00815) | oppD | 135594..136643 (+) | 1050 | WP_002960869.1 | ABC transporter ATP-binding protein | Regulator |
| DK181_RS00820 (DK182_00820) | amiF | 136640..137563 (+) | 924 | WP_002999065.1 | ABC transporter ATP-binding protein | Regulator |
| DK181_RS00825 (DK182_00825) | - | 137800..139485 (-) | 1686 | WP_002960871.1 | MFS transporter | - |
| DK181_RS00830 (DK182_00830) | - | 139617..140138 (+) | 522 | WP_002960873.1 | PadR family transcriptional regulator | - |
| DK181_RS00835 (DK182_00835) | - | 140148..140456 (+) | 309 | WP_002960875.1 | LlsX family protein | - |
| DK181_RS00845 (DK182_00845) | - | 140816..141352 (+) | 537 | Protein_126 | TMEM175 family protein | - |
| DK181_RS00850 (DK182_00850) | - | 141413..142939 (-) | 1527 | Protein_127 | IS1182 family transposase | - |
| DK181_RS10775 | - | 143434..143577 (-) | 144 | WP_002959475.1 | hypothetical protein | - |
| DK181_RS00855 (DK182_00855) | - | 143567..143857 (-) | 291 | WP_002959477.1 | hypothetical protein | - |
| DK181_RS00860 (DK182_00860) | - | 144079..144801 (+) | 723 | WP_002959479.1 | ABC transporter ATP-binding protein | - |
| DK181_RS00865 (DK182_00865) | - | 144806..145945 (+) | 1140 | WP_002959481.1 | ABC transporter permease | - |
| DK181_RS00870 (DK182_00870) | - | 146169..146789 (+) | 621 | WP_002959483.1 | TetR/AcrR family transcriptional regulator | - |
| DK181_RS00875 (DK182_00875) | - | 146967..147229 (-) | 263 | Protein_133 | type II toxin-antitoxin system YafQ family toxin | - |
| DK181_RS00880 (DK182_00880) | - | 147233..147514 (-) | 282 | WP_002959487.1 | type II toxin-antitoxin system RelB/DinJ family antitoxin | - |
| DK181_RS00885 (DK182_00885) | - | 147671..148537 (-) | 867 | WP_002959489.1 | LysR family transcriptional regulator | - |
| DK181_RS00890 (DK182_00890) | - | 148648..149508 (+) | 861 | WP_002959490.1 | aldo/keto reductase | - |
| DK181_RS00895 (DK182_00895) | - | 149608..149970 (-) | 363 | WP_002959493.1 | class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI | - |
| DK181_RS00900 (DK182_00900) | - | 150331..152715 (-) | 2385 | WP_019771344.1 | HAD-IC family P-type ATPase | - |
| DK181_RS00905 (DK182_00905) | - | 152935..153303 (+) | 369 | WP_019781971.1 | DUF1033 family protein | - |
| DK181_RS00910 (DK182_00910) | comGA/cglA | 153729..154676 (+) | 948 | WP_002959503.1 | competence type IV pilus ATPase ComGA | Machinery gene |
| DK181_RS00915 (DK182_00915) | comYB | 154600..155643 (+) | 1044 | WP_002959504.1 | competence type IV pilus assembly protein ComGB | Machinery gene |
| DK181_RS00920 (DK182_00920) | comYC | 155640..155966 (+) | 327 | WP_019770073.1 | competence type IV pilus major pilin ComGC | Machinery gene |
| DK181_RS00925 (DK182_00925) | comYD | 155920..156354 (+) | 435 | WP_254051091.1 | competence type IV pilus minor pilin ComGD | Machinery gene |
| DK181_RS00930 (DK182_00930) | comYE | 156326..156619 (+) | 294 | WP_002959510.1 | competence type IV pilus minor pilin ComGE | Machinery gene |
| DK181_RS00935 (DK182_00935) | comYF | 156603..157040 (+) | 438 | WP_002959513.1 | competence type IV pilus minor pilin ComGF | Machinery gene |
| DK181_RS00940 (DK182_00940) | comGG | 157018..157479 (+) | 462 | WP_002959515.1 | competence type IV pilus minor pilin ComGG | - |
| DK181_RS00950 (DK182_00950) | - | 157681..157947 (+) | 267 | WP_002959516.1 | type II toxin-antitoxin system RelE/ParE family toxin | - |
| DK181_RS00955 (DK182_00955) | - | 157934..158209 (+) | 276 | WP_002959518.1 | helix-turn-helix domain-containing protein | - |
| DK181_RS00960 (DK182_00960) | comYH | 158308..159261 (+) | 954 | WP_019771347.1 | class I SAM-dependent methyltransferase | Machinery gene |
| DK181_RS00965 (DK182_00965) | - | 159324..160520 (+) | 1197 | WP_002959522.1 | acetate kinase | - |
| DK181_RS00970 (DK182_00970) | - | 160998..161903 (+) | 906 | WP_002959524.1 | LysR family transcriptional regulator | - |
| DK181_RS00975 (DK182_00975) | - | 162010..162276 (+) | 267 | WP_002959526.1 | ACT domain-containing protein | - |
| DK181_RS00980 (DK182_00980) | - | 162288..163625 (+) | 1338 | WP_002959528.1 | PFL family protein | - |
| DK181_RS00985 (DK182_00985) | - | 163864..164166 (-) | 303 | Protein_154 | hypothetical protein | - |
| DK181_RS00990 (DK182_00990) | - | 164193..165128 (-) | 936 | WP_019773382.1 | IS30 family transposase | - |
| DK181_RS00995 (DK182_00995) | - | 165319..165750 (-) | 432 | WP_002961167.1 | MarR family winged helix-turn-helix transcriptional regulator | - |
| DK181_RS01000 (DK182_01000) | - | 165889..166590 (+) | 702 | WP_002961168.1 | histidine phosphatase family protein | - |
| DK181_RS01005 (DK182_01005) | - | 166577..167344 (+) | 768 | WP_002961169.1 | M15 family metallopeptidase | - |
| DK181_RS01010 (DK182_01010) | - | 167509..168093 (+) | 585 | WP_002961170.1 | glycoside hydrolase family 73 protein | - |
| DK181_RS01015 (DK182_01015) | hrcA | 168260..169294 (+) | 1035 | WP_002961171.1 | heat-inducible transcriptional repressor HrcA | - |
| DK181_RS01020 (DK182_01020) | grpE | 169314..169865 (+) | 552 | WP_002961172.1 | nucleotide exchange factor GrpE | - |
Sequence
Protein
Download Length: 97 a.a. Molecular weight: 10906.87 Da Isoelectric Point: 10.6169
>NTDB_id=293148 DK181_RS00930 WP_002959510.1 156326..156619(+) (comYE) [Streptococcus sobrinus strain SL1]
MVAIKKRKIKAYILLESLIALAVLVTIVTLILTEINRDRQELVASLHRQEVLNLAQMAVQTKQDSLSLNGVTVQVQRTST
SIRVYENGREVLHVAKN
MVAIKKRKIKAYILLESLIALAVLVTIVTLILTEINRDRQELVASLHRQEVLNLAQMAVQTKQDSLSLNGVTVQVQRTST
SIRVYENGREVLHVAKN
Nucleotide
Download Length: 294 bp
>NTDB_id=293148 DK181_RS00930 WP_002959510.1 156326..156619(+) (comYE) [Streptococcus sobrinus strain SL1]
GTGGTCGCTATAAAAAAACGGAAAATTAAAGCCTATATTCTCTTAGAAAGCCTGATAGCTCTAGCAGTCTTGGTCACCAT
TGTCACCTTAATCTTGACGGAAATCAACCGAGATCGTCAGGAGCTGGTGGCTAGTCTTCATCGCCAGGAAGTTCTCAACC
TTGCCCAGATGGCAGTTCAGACCAAACAGGACAGTCTCAGTCTGAACGGGGTGACGGTTCAGGTTCAGCGGACTTCGACT
AGCATCAGGGTTTATGAAAATGGCAGGGAGGTTCTCCATGTGGCTAAAAACTAG
GTGGTCGCTATAAAAAAACGGAAAATTAAAGCCTATATTCTCTTAGAAAGCCTGATAGCTCTAGCAGTCTTGGTCACCAT
TGTCACCTTAATCTTGACGGAAATCAACCGAGATCGTCAGGAGCTGGTGGCTAGTCTTCATCGCCAGGAAGTTCTCAACC
TTGCCCAGATGGCAGTTCAGACCAAACAGGACAGTCTCAGTCTGAACGGGGTGACGGTTCAGGTTCAGCGGACTTCGACT
AGCATCAGGGTTTATGAAAATGGCAGGGAGGTTCTCCATGTGGCTAAAAACTAG
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comYE | Streptococcus mutans UA140 |
52.083 |
98.969 |
0.515 |
| comYE | Streptococcus mutans UA159 |
52.083 |
98.969 |
0.515 |
| comGE/cglE | Streptococcus pneumoniae D39 |
42.391 |
94.845 |
0.402 |
| comGE/cglE | Streptococcus pneumoniae TIGR4 |
42.391 |
94.845 |
0.402 |
| comGE/cglE | Streptococcus pneumoniae R6 |
42.391 |
94.845 |
0.402 |
| comGE/cglE | Streptococcus pneumoniae Rx1 |
42.391 |
94.845 |
0.402 |
| comGE | Lactococcus lactis subsp. cremoris KW2 |
39.362 |
96.907 |
0.381 |
| comGE/cglE | Streptococcus mitis NCTC 12261 |
40.217 |
94.845 |
0.381 |
| comGE/cglE | Streptococcus mitis SK321 |
40.217 |
94.845 |
0.381 |