Detailed information    

insolico Bioinformatically predicted

Overview

Name   sinI   Type   Regulator
Locus tag   DIC78_RS19125 Genome accession   NZ_CP029364
Coordinates   3704720..3704893 (-) Length   57 a.a.
NCBI ID   WP_127696772.1    Uniprot ID   -
Organism   Bacillus halotolerans strain ZB201702     
Function   inhibit the expression of sinR (predicted from homology)   
Competence regulation

Genomic Context

Location: 3699720..3709893
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  DIC78_RS19080 (DIC78_19105) comGE 3700072..3700419 (+) 348 WP_127696770.1 competence type IV pilus minor pilin ComGE Machinery gene
  DIC78_RS19085 (DIC78_19110) comGF 3700445..3700828 (+) 384 WP_038954226.1 competence type IV pilus minor pilin ComGF Machinery gene
  DIC78_RS19090 (DIC78_19115) comGG 3700829..3701203 (+) 375 WP_106020094.1 competence type IV pilus minor pilin ComGG Machinery gene
  DIC78_RS19095 (DIC78_19120) - 3701275..3701454 (+) 180 WP_003236949.1 YqzE family protein -
  DIC78_RS19100 (DIC78_19125) - 3701497..3701820 (-) 324 WP_024122040.1 YqzG/YhdC family protein -
  DIC78_RS19105 (DIC78_19130) tapA 3702097..3702858 (+) 762 WP_106020093.1 amyloid fiber anchoring/assembly protein TapA -
  DIC78_RS19110 (DIC78_19135) sipW 3702830..3703414 (+) 585 WP_105955579.1 signal peptidase I SipW -
  DIC78_RS19115 (DIC78_19140) tasA 3703479..3704264 (+) 786 WP_127696771.1 biofilm matrix protein TasA -
  DIC78_RS19120 (DIC78_19145) sinR 3704351..3704686 (-) 336 WP_003226345.1 transcriptional regulator SinR Regulator
  DIC78_RS19125 (DIC78_19150) sinI 3704720..3704893 (-) 174 WP_127696772.1 anti-repressor SinI Regulator
  DIC78_RS19130 (DIC78_19155) - 3705077..3705871 (-) 795 WP_127696773.1 YqhG family protein -
  DIC78_RS19135 (DIC78_19160) - 3705891..3707564 (-) 1674 WP_127696774.1 DEAD/DEAH box helicase -
  DIC78_RS19140 (DIC78_19165) gcvT 3708008..3709096 (+) 1089 WP_127696775.1 glycine cleavage system aminomethyltransferase GcvT -

Sequence

Protein


Download         Length: 57 a.a.        Molecular weight: 6657.59 Da        Isoelectric Point: 6.7231

>NTDB_id=292011 DIC78_RS19125 WP_127696772.1 3704720..3704893(-) (sinI) [Bacillus halotolerans strain ZB201702]
MKNAKQEHFELDQEWVELMIEAREANISPEEIRKYLLLNKKSAHPGPAARSHTINPF

Nucleotide


Download         Length: 174 bp        

>NTDB_id=292011 DIC78_RS19125 WP_127696772.1 3704720..3704893(-) (sinI) [Bacillus halotolerans strain ZB201702]
ATGAAAAATGCAAAACAAGAGCACTTCGAATTAGATCAAGAATGGGTTGAATTAATGATAGAAGCCAGAGAAGCAAATAT
CAGCCCTGAGGAAATACGCAAATATTTACTTTTAAACAAAAAGTCTGCTCATCCTGGTCCGGCAGCCAGAAGTCATACCA
TAAATCCTTTCTGA

Domains

Predicted by InterproScan.

Anti-repressor SinI (SinI)

(11-36)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  sinI Bacillus subtilis subsp. subtilis str. 168

94.737

100

0.947

Multiple sequence alignment