Detailed information NTG0027482

Bioinformatically predicted

Overview

• Name: comGE
• Type: Machinery gene
• Locus tag: LLMG_RS12055
• Genome accession: NC_009004
• Coordinates: 2344278..2344574 (-)
• Length: 98 a.a.
• NCBI ID: WP_014735175.1
• Uniprot ID: -
• Organism: Lactococcus cremoris subsp. cremoris MG1363
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
ICE	2339003..2352968	2344278..2344574	within	0

Gene organization within MGE regions

Location: 2339003..2352968

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
LLMG_RS13320	-	2339003..2340398 (-)	1396	Protein_2335	IS3 family transposase	-
LLMG_RS12025 (llmg_2398)	-	2340471..2341280 (-)	810	WP_011836038.1	metal ABC transporter permease	-
LLMG_RS12030 (llmg_2399)	-	2341273..2342010 (-)	738	WP_011836039.1	metal ABC transporter ATP-binding protein	-
LLMG_RS12035 (llmg_2400)	-	2342189..2343031 (-)	843	WP_011836040.1	metal ABC transporter solute-binding protein, Zn/Mn family	-
LLMG_RS12040 (llmg_2401)	-	2343028..2343465 (-)	438	WP_011836041.1	zinc-dependent MarR family transcriptional regulator	-
LLMG_RS12045 (llmg_2402)	comGG	2343546..2343845 (-)	300	WP_011836042.1	competence type IV pilus minor pilin ComGG	Machinery gene
LLMG_RS12050 (llmg_2403)	comGF	2343869..2344294 (-)	426	WP_014735174.1	competence type IV pilus minor pilin ComGF	Machinery gene
LLMG_RS12055 (llmg_2404)	comGE	2344278..2344574 (-)	297	WP_014735175.1	competence type IV pilus minor pilin ComGE	Machinery gene
LLMG_RS12060 (llmg_2405)	comGD	2344546..2344977 (-)	432	WP_050750513.1	competence type IV pilus minor pilin ComGD	Machinery gene
LLMG_RS12065 (llmg_2406)	comGC	2344937..2345314 (-)	378	WP_011836046.1	competence type IV pilus major pilin ComGC	Machinery gene
LLMG_RS12070 (llmg_2407)	comGB	2345332..2346357 (-)	1026	WP_042211510.1	competence type IV pilus assembly protein ComGB	Machinery gene
LLMG_RS12075 (llmg_2408)	comGA	2346257..2347237 (-)	981	WP_011836048.1	competence type IV pilus ATPase ComGA	Machinery gene
LLMG_RS12080 (llmg_2409)	-	2347351..2351133 (-)	3783	Protein_2347	PolC-type DNA polymerase III	-
LLMG_RS14065	-	2351665..2352258 (-)	594	Protein_2348	PolC-type DNA polymerase III N-terminal domain-containing protein	-
LLMG_RS12085 (llmg_2410)	-	2352432..2352968 (-)	537	WP_011836050.1	hypothetical protein	-

Sequence

Protein

• Length: 98 a.a.
• Molecular weight: 10976.61 Da
• Isoelectric Point: 5.0659

>NTDB_id=27482 LLMG_RS12055 WP_014735175.1 2344278..2344574(-) (comGE) [Lactococcus cremoris subsp. cremoris MG1363]
MENIKRKSIKGYILLESLISMALLSFLVTFLLSSLTNSRQQEAQENQQIESLNVAQMAIESQLTELSLNGSVIKIRQDST
ATIISDHGKEILRLEAQN

Nucleotide

• Length: 297 bp

>NTDB_id=27482 LLMG_RS12055 WP_014735175.1 2344278..2344574(-) (comGE) [Lactococcus cremoris subsp. cremoris MG1363]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATATATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
AGTCACTTTTCTCTTGAGTTCTCTTACTAATTCTCGTCAGCAAGAGGCACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGTTGACGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (13-94)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE	Lactococcus lactis subsp. cremoris KW2	100	100	1