Detailed information    

insolico Bioinformatically predicted

Overview


Name   comGE   Type   Machinery gene
Locus tag   LACR_RS11715 Genome accession   NC_008527
Coordinates   2248610..2248906 (-) Length   98 a.a.
NCBI ID   WP_011677183.1    Uniprot ID   -
Organism   Lactococcus cremoris subsp. cremoris SK11     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context


Location: 2243610..2253906
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LACR_RS11685 (LACR_2417) - 2244804..2245613 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LACR_RS11690 (LACR_2418) - 2245606..2246343 (-) 738 WP_011677178.1 metal ABC transporter ATP-binding protein -
  LACR_RS11695 (LACR_2419) - 2246522..2247364 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LACR_RS11700 (LACR_2420) - 2247361..2247798 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LACR_RS11705 (LACR_2421) comGG 2247878..2248177 (-) 300 WP_011677181.1 competence type IV pilus minor pilin ComGG Machinery gene
  LACR_RS11710 (LACR_2422) comGF 2248201..2248647 (-) 447 WP_041167483.1 competence type IV pilus minor pilin ComGF Machinery gene
  LACR_RS11715 (LACR_2423) comGE 2248610..2248906 (-) 297 WP_011677183.1 competence type IV pilus minor pilin ComGE Machinery gene
  LACR_RS14670 (LACR_2424) comGD 2248878..2249066 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LACR_RS11725 (LACR_2425) comGC 2249268..2249618 (-) 351 WP_050574401.1 competence type IV pilus major pilin ComGC Machinery gene
  LACR_RS11730 (LACR_2426) comGB 2249663..2250689 (-) 1027 Protein_2284 competence type IV pilus assembly protein ComGB -
  LACR_RS11735 - 2250589..2251410 (-) 822 Protein_2285 ATPase, T2SS/T4P/T4SS family -
  LACR_RS11740 (LACR_2428) - 2251513..2252403 (+) 891 WP_011677100.1 IS982 family transposase -
  LACR_RS11745 comGA 2252385..2252576 (-) 192 WP_041167484.1 hypothetical protein Machinery gene

Sequence


Protein


Download         Length: 98 a.a.        Molecular weight: 11016.75 Da        Isoelectric Point: 4.7805

>NTDB_id=26581 LACR_RS11715 WP_011677183.1 2248610..2248906(-) (comGE) [Lactococcus cremoris subsp. cremoris SK11]
MENIKRKSIKGCILLESLISMALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDST
ETIISDHGKEILRLEAQN

Nucleotide


Download         Length: 297 bp        

>NTDB_id=26581 LACR_RS11715 WP_011677183.1 2248610..2248906(-) (comGE) [Lactococcus cremoris subsp. cremoris SK11]
GTGGAAAATATAAAAAGAAAATCAATTAAGGGATGTATACTTCTTGAGAGCCTAATTAGTATGGCATTATTGAGCTTTTT
GGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCAACAAATTGAGTCCTTAAATG
TAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAAAAATAAGACAAGATTCGACT
GAAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

94.898

100

0.949


Multiple sequence alignment