Detailed information NTG0259493

Bioinformatically predicted

Overview

• Name: comGE/cglE
• Type: Machinery gene
• Locus tag: CXP32_RS10495
• Genome accession: NZ_CP025256
• Coordinates: 1959389..1959691 (-)
• Length: 100 a.a.
• NCBI ID: WP_000413382.1
• Uniprot ID: -
• Organism: Streptococcus pneumoniae strain Xen35
• Function: dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology) DNA binding and uptake

Genomic Context

Location: 1954389..1964691

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
CXP32_RS10465 (CXP32_10465)	rnpA	1955068..1955439 (-)	372	WP_000739253.1	ribonuclease P protein component	-
CXP32_RS12635	-	1955456..1955587 (-)	132	WP_000768904.1	hypothetical protein	-
CXP32_RS10470 (CXP32_10470)	-	1955588..1956778 (-)	1191	WP_000167757.1	acetate kinase	-
CXP32_RS10475 (CXP32_10475)	comYH	1956829..1957782 (-)	954	WP_000345135.1	class I SAM-dependent methyltransferase	Machinery gene
CXP32_RS10480 (CXP32_10480)	-	1957843..1958437 (-)	595	Protein_1940	methyltransferase domain-containing protein	-
CXP32_RS10485 (CXP32_10485)	comGG/cglG	1958574..1958987 (-)	414	WP_000265622.1	competence type IV pilus minor pilin ComGG	Machinery gene
CXP32_RS10490 (CXP32_10490)	comGF/cglF	1958965..1959426 (-)	462	WP_000250534.1	competence type IV pilus minor pilin ComGF	Machinery gene
CXP32_RS10495 (CXP32_10495)	comGE/cglE	1959389..1959691 (-)	303	WP_000413382.1	competence type IV pilus minor pilin ComGE	Machinery gene
CXP32_RS10500 (CXP32_10500)	comGD/cglD	1959654..1960058 (-)	405	WP_000588028.1	competence type IV pilus minor pilin ComGD	Machinery gene
CXP32_RS10505 (CXP32_10505)	comGC/cglC	1960051..1960377 (-)	327	WP_000738627.1	comG operon protein ComGC	Machinery gene
CXP32_RS10510 (CXP32_10510)	comGB/cglB	1960379..1961395 (-)	1017	WP_074196785.1	competence type IV pilus assembly protein ComGB	Machinery gene
CXP32_RS10515 (CXP32_10515)	comGA/cglA/cilD	1961343..1962284 (-)	942	WP_000249564.1	competence type IV pilus ATPase ComGA	Machinery gene
CXP32_RS10520 (CXP32_10520)	-	1962360..1962725 (-)	366	WP_000286415.1	DUF1033 family protein	-
CXP32_RS10525 (CXP32_10525)	-	1962876..1963934 (-)	1059	WP_000649468.1	zinc-dependent alcohol dehydrogenase family protein	-

Sequence

Protein

• Length: 100 a.a.
• Molecular weight: 11108.08 Da
• Isoelectric Point: 9.7273

>NTDB_id=259493 CXP32_RS10495 WP_000413382.1 1959389..1959691(-) (comGE/cglE) [Streptococcus pneumoniae strain Xen35]
MEKLNALRKQKIRAVILLEAVVALAIFASIATLLLGQIQKNRQEEAKILQKEEVLRVAKMALQTGQNQVSINGVEIQVFS
SEKGLEVYHGSEQLLAIKEP

Nucleotide

• Length: 303 bp

>NTDB_id=259493 CXP32_RS10495 WP_000413382.1 1959389..1959691(-) (comGE/cglE) [Streptococcus pneumoniae strain Xen35]
ATGGAAAAATTAAACGCATTAAGGAAACAAAAAATTAGGGCAGTGATTTTACTGGAAGCAGTAGTCGCTCTAGCTATCTT
TGCCAGCATTGCGACCCTCCTTTTGGGACAAATTCAAAAAAATAGGCAAGAGGAAGCAAAAATCTTGCAAAAGGAAGAAG
TCTTGAGGGTAGCTAAGATGGCCCTGCAGACGGGGCAAAATCAGGTAAGCATCAACGGAGTTGAGATTCAGGTATTTTCT
AGTGAAAAAGGATTGGAGGTCTACCATGGTTCAGAACAGTTGTTGGCAATCAAAGAGCCATAA

Domains

Predicted by InterproScan.

• Type II secretory pathway pseudopilin (ComGE) (16-97)

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
comGE/cglE	Streptococcus pneumoniae Rx1	100	100	1
comGE/cglE	Streptococcus pneumoniae D39	100	100	1
comGE/cglE	Streptococcus pneumoniae R6	100	100	1
comGE/cglE	Streptococcus pneumoniae TIGR4	100	100	1
comGE/cglE	Streptococcus mitis NCTC 12261	98	100	0.98
comGE/cglE	Streptococcus mitis SK321	98	100	0.98
comYE	Streptococcus mutans UA140	44.444	90	0.4
comYE	Streptococcus mutans UA159	44.444	90	0.4