Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   CLD04_RS02550 Genome accession   NZ_CP023257
Coordinates   482253..482375 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain TLO3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 477253..487375
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CLD04_RS02535 (CLD04_02535) yclJ 478866..479549 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  CLD04_RS02540 (CLD04_02540) yclK 479536..480957 (+) 1422 WP_072557076.1 two-component system sensor histidine kinase YclK -
  CLD04_RS02545 (CLD04_02545) rapC 481121..482269 (+) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  CLD04_RS02550 (CLD04_02550) phrC 482253..482375 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  CLD04_RS02555 (CLD04_02555) yczM 482475..482564 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  CLD04_RS02560 (CLD04_02560) yczN 482646..482759 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  CLD04_RS02565 (CLD04_02565) thrD 482913..484277 (-) 1365 WP_033883679.1 aspartate kinase -
  CLD04_RS02570 (CLD04_02570) ceuB 484662..485612 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  CLD04_RS02575 (CLD04_02575) yclO 485605..486552 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  CLD04_RS02580 (CLD04_02580) yclP 486546..487304 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=245518 CLD04_RS02550 WP_003224994.1 482253..482375(+) (phrC) [Bacillus subtilis strain TLO3]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=245518 CLD04_RS02550 WP_003224994.1 482253..482375(+) (phrC) [Bacillus subtilis strain TLO3]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment