Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   CDO84_RS01150 Genome accession   NZ_CP021911
Coordinates   259834..259956 (+) Length   40 a.a.
NCBI ID   WP_014662771.1    Uniprot ID   A0A292GN16
Organism   Bacillus sp. MD-5     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 254834..264956
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CDO84_RS01135 (CDO84_01135) yclJ 256448..257131 (+) 684 WP_040084391.1 two-component system response regulator YclJ -
  CDO84_RS01140 (CDO84_01140) yclK 257118..258539 (+) 1422 WP_082033070.1 two-component system sensor histidine kinase YclK -
  CDO84_RS01145 (CDO84_01145) rapC 258702..259850 (+) 1149 WP_014662770.1 response regulator aspartate phosphatase RapC Regulator
  CDO84_RS01150 (CDO84_01150) phrC 259834..259956 (+) 123 WP_014662771.1 phosphatase RapC inhibitor PhrC Regulator
  CDO84_RS01155 (CDO84_01155) - 260054..260164 (-) 111 WP_040084173.1 YjcZ family sporulation protein -
  CDO84_RS01160 (CDO84_01160) - 260307..261671 (-) 1365 WP_014662772.1 aspartate kinase -
  CDO84_RS01165 (CDO84_01165) ceuB 262056..263006 (+) 951 WP_040084171.1 petrobactin ABC transporter permease YclN Machinery gene
  CDO84_RS01170 (CDO84_01170) yclO 262999..263946 (+) 948 WP_040084169.1 petrobactin ABC transporter permease YclO -
  CDO84_RS01175 (CDO84_01175) yclP 263940..264698 (+) 759 WP_040084168.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4221.02 Da        Isoelectric Point: 8.0579

>NTDB_id=234769 CDO84_RS01150 WP_014662771.1 259834..259956(+) (phrC) [Bacillus sp. MD-5]
MKLKSKLFVICLAAAAIFTAAGVSAHAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=234769 CDO84_RS01150 WP_014662771.1 259834..259956(+) (phrC) [Bacillus sp. MD-5]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTCATGC
GGAAGCACTCGACTTTCATGTGACGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB A0A292GN16

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment