Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   CD007_RS02135 Genome accession   NZ_CP021903
Coordinates   421830..421952 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain ge28     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 416830..426952
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  CD007_RS02120 (CD007_02120) yclJ 418443..419126 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  CD007_RS02125 (CD007_02125) yclK 419113..420534 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  CD007_RS02130 (CD007_02130) rapC 420698..421846 (+) 1149 WP_043940053.1 response regulator aspartate phosphatase RapC Regulator
  CD007_RS02135 (CD007_02135) phrC 421830..421952 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  CD007_RS02140 (CD007_02140) yczM 422054..422143 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  CD007_RS02145 (CD007_02145) yczN 422225..422338 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  CD007_RS02150 (CD007_02150) thrD 422492..423856 (-) 1365 WP_043940054.1 aspartate kinase -
  CD007_RS02155 (CD007_02155) ceuB 424241..425191 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  CD007_RS02160 (CD007_02160) yclO 425184..426131 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  CD007_RS02165 (CD007_02165) yclP 426125..426883 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=234583 CD007_RS02135 WP_003224994.1 421830..421952(+) (phrC) [Bacillus subtilis strain ge28]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=234583 CD007_RS02135 WP_003224994.1 421830..421952(+) (phrC) [Bacillus subtilis strain ge28]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment