Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   C2H93_RS00410 Genome accession   NZ_CP026036
Coordinates   100957..101079 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PK5_16     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 95957..106079
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  C2H93_RS00395 (C2H93_00380) yclJ 97570..98253 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  C2H93_RS00400 (C2H93_00385) yclK 98240..99661 (+) 1422 WP_080121165.1 two-component system sensor histidine kinase YclK -
  C2H93_RS00405 (C2H93_00390) rapC 99825..100973 (+) 1149 WP_038828432.1 response regulator aspartate phosphatase RapC Regulator
  C2H93_RS00410 (C2H93_00395) phrC 100957..101079 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  C2H93_RS00415 (C2H93_00400) yczM 101179..101268 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  C2H93_RS00420 (C2H93_00405) yczN 101350..101463 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  C2H93_RS00425 (C2H93_00410) thrD 101616..102980 (-) 1365 WP_021481755.1 aspartate kinase -
  C2H93_RS00430 (C2H93_00415) ceuB 103365..104315 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  C2H93_RS00435 (C2H93_00420) yclO 104308..105255 (+) 948 WP_141949511.1 petrobactin ABC transporter permease YclO -
  C2H93_RS00440 (C2H93_00425) yclP 105249..106007 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=222444 C2H93_RS00410 WP_003224994.1 100957..101079(+) (phrC) [Bacillus subtilis strain PK5_16]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=222444 C2H93_RS00410 WP_003224994.1 100957..101079(+) (phrC) [Bacillus subtilis strain PK5_16]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1