Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   B4U62_RS02180 Genome accession   NZ_CP020102
Coordinates   430004..430126 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain NCIB 3610     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 425004..435126
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  B4U62_RS02165 (B4U62_02165) yclJ 426618..427301 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  B4U62_RS02170 (B4U62_02170) yclK 427288..428709 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  B4U62_RS02175 (B4U62_02175) rapC 428872..430020 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  B4U62_RS02180 (B4U62_02180) phrC 430004..430126 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  B4U62_RS02185 (B4U62_02185) yczM 430226..430315 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  B4U62_RS02190 (B4U62_02190) yczN 430397..430510 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  B4U62_RS02195 (B4U62_02195) thrD 430664..432028 (-) 1365 WP_003234493.1 aspartate kinase -
  B4U62_RS02200 (B4U62_02200) ceuB 432413..433363 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  B4U62_RS02205 (B4U62_02205) yclO 433356..434303 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  B4U62_RS02210 (B4U62_02210) yclP 434297..435055 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=221133 B4U62_RS02180 WP_003224994.1 430004..430126(+) (phrC) [Bacillus subtilis strain NCIB 3610]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=221133 B4U62_RS02180 WP_003224994.1 430004..430126(+) (phrC) [Bacillus subtilis strain NCIB 3610]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment