Detailed information NTG0210996

Bioinformatically predicted

Overview

• Name: pilB
• Type: Machinery gene
• Locus tag: BI314_RS07560
• Genome accession: NZ_CP018847
• Coordinates: 1683727..1683846 (+)
• Length: 39 a.a.
• NCBI ID: WP_005915819.1
• Uniprot ID: A0A7S6YV99
• Organism: Xanthomonas citri pv. citri strain LL074-4
• Function: power the assembly of type IV pilus (predicted from homology) DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type	MGE coordinates	Gene coordinates	Relative position	Distance (bp)
Genomic island	1684075..1707557	1683727..1683846	flank	229

Gene organization within MGE regions

Location: 1683727..1707557

Locus tag	Gene name	Coordinates (strand)	Size (bp)	Protein ID	Product	Description
BI314_RS07560 (BI314_07560)	pilB	1683727..1683846 (+)	120	WP_005915819.1	hypothetical protein	Machinery gene
BI314_RS07565 (BI314_07565)	-	1683978..1684145 (+)	168	WP_015463523.1	hypothetical protein	-
BI314_RS07570 (BI314_07570)	pilR	1684368..1685762 (-)	1395	WP_015463522.1	sigma-54 dependent transcriptional regulator	Regulator
BI314_RS07575 (BI314_07575)	-	1686087..1687700 (-)	1614	WP_003488599.1	HAMP domain-containing sensor histidine kinase	-
BI314_RS07580 (BI314_07580)	sucC	1687932..1689101 (+)	1170	WP_005915812.1	ADP-forming succinate--CoA ligase subunit beta	-
BI314_RS07585 (BI314_07585)	sucD	1689126..1690001 (+)	876	WP_005921370.1	succinate--CoA ligase subunit alpha	-
BI314_RS07590 (BI314_07590)	-	1690088..1690603 (+)	516	WP_011052123.1	hypothetical protein	-
BI314_RS07595 (BI314_07595)	-	1690558..1691673 (-)	1116	WP_011052122.1	IS1595 family transposase	-
BI314_RS07600 (BI314_07600)	-	1691901..1692185 (-)	285	WP_016849322.1	hypothetical protein	-
BI314_RS07610 (BI314_07610)	xopAI	1693516..1694406 (-)	891	WP_011052119.1	type III secretion system effector XopAI	-
BI314_RS07615 (BI314_07615)	-	1694540..1695621 (-)	1082	Protein_1391	DNA-binding protein	-
BI314_RS07620 (BI314_07620)	xopE	1695952..1697028 (-)	1077	WP_041470856.1	XopE/AvrPphe family type III secretion system effector	-
BI314_RS07625 (BI314_07625)	-	1697161..1698216 (-)	1056	WP_011052969.1	DNA-binding protein	-
BI314_RS07630 (BI314_07630)	-	1698408..1699682 (+)	1275	WP_011052968.1	tyrosine-type recombinase/integrase	-
BI314_RS07635 (BI314_07635)	-	1699690..1702679 (+)	2990	Protein_1395	Tn3-like element TnXax1 family transposase	-
BI314_RS07640 (BI314_07640)	-	1702812..1704089 (+)	1278	WP_011052115.1	lytic murein transglycosylase	-
BI314_RS07645 (BI314_07645)	avrXacE2	1704175..1705245 (+)	1071	WP_011052114.1	type III secretion system effector avirulence protein AvrXacE2	-
BI314_RS07655 (BI314_07655)	-	1706005..1707172 (-)	1168	Protein_1398	IS3 family transposase	-
BI314_RS07665 (BI314_07665)	-	1707210..1707557 (+)	348	WP_040107789.1	endonuclease domain-containing protein	-

Sequence

Protein

• Length: 39 a.a.
• Molecular weight: 4178.84 Da
• Isoelectric Point: 9.0113

>NTDB_id=210996 BI314_RS07560 WP_005915819.1 1683727..1683846(+) (pilB) [Xanthomonas citri pv. citri strain LL074-4]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD

Nucleotide

• Length: 120 bp

>NTDB_id=210996 BI314_RS07560 WP_005915819.1 1683727..1683846(+) (pilB) [Xanthomonas citri pv. citri strain LL074-4]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA

Domains

No domain identified.

3D structure

• AlphaFold DB: A0A7S6YV99

Similar proteins

Only experimentally validated proteins are listed.

Protein	Organism	Identities (%)	Coverage (%)	Ha-value
pilB	Acinetobacter baylyi ADP1	51.282	100	0.513
pilB	Acinetobacter baumannii D1279779	48.718	100	0.487
pilB	Vibrio cholerae strain A1552	45.714	89.744	0.41
pilB	Legionella pneumophila strain ERS1305867	38.462	100	0.385