Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | BI314_RS07560 | Genome accession | NZ_CP018847 |
| Coordinates | 1683727..1683846 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. citri strain LL074-4 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 1684075..1707557 | 1683727..1683846 | flank | 229 |
Gene organization within MGE regions
Location: 1683727..1707557
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| BI314_RS07560 (BI314_07560) | pilB | 1683727..1683846 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| BI314_RS07565 (BI314_07565) | - | 1683978..1684145 (+) | 168 | WP_015463523.1 | hypothetical protein | - |
| BI314_RS07570 (BI314_07570) | pilR | 1684368..1685762 (-) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| BI314_RS07575 (BI314_07575) | - | 1686087..1687700 (-) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| BI314_RS07580 (BI314_07580) | sucC | 1687932..1689101 (+) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| BI314_RS07585 (BI314_07585) | sucD | 1689126..1690001 (+) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| BI314_RS07590 (BI314_07590) | - | 1690088..1690603 (+) | 516 | WP_011052123.1 | hypothetical protein | - |
| BI314_RS07595 (BI314_07595) | - | 1690558..1691673 (-) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| BI314_RS07600 (BI314_07600) | - | 1691901..1692185 (-) | 285 | WP_016849322.1 | hypothetical protein | - |
| BI314_RS07610 (BI314_07610) | xopAI | 1693516..1694406 (-) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| BI314_RS07615 (BI314_07615) | - | 1694540..1695621 (-) | 1082 | Protein_1391 | DNA-binding protein | - |
| BI314_RS07620 (BI314_07620) | xopE | 1695952..1697028 (-) | 1077 | WP_041470856.1 | XopE/AvrPphe family type III secretion system effector | - |
| BI314_RS07625 (BI314_07625) | - | 1697161..1698216 (-) | 1056 | WP_011052969.1 | DNA-binding protein | - |
| BI314_RS07630 (BI314_07630) | - | 1698408..1699682 (+) | 1275 | WP_011052968.1 | tyrosine-type recombinase/integrase | - |
| BI314_RS07635 (BI314_07635) | - | 1699690..1702679 (+) | 2990 | Protein_1395 | Tn3-like element TnXax1 family transposase | - |
| BI314_RS07640 (BI314_07640) | - | 1702812..1704089 (+) | 1278 | WP_011052115.1 | lytic murein transglycosylase | - |
| BI314_RS07645 (BI314_07645) | avrXacE2 | 1704175..1705245 (+) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| BI314_RS07655 (BI314_07655) | - | 1706005..1707172 (-) | 1168 | Protein_1398 | IS3 family transposase | - |
| BI314_RS07665 (BI314_07665) | - | 1707210..1707557 (+) | 348 | WP_040107789.1 | endonuclease domain-containing protein | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=210996 BI314_RS07560 WP_005915819.1 1683727..1683846(+) (pilB) [Xanthomonas citri pv. citri strain LL074-4]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=210996 BI314_RS07560 WP_005915819.1 1683727..1683846(+) (pilB) [Xanthomonas citri pv. citri strain LL074-4]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |