Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   BSK2_RS02140 Genome accession   NZ_CP020367
Coordinates   422604..422726 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain GQJK2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 417604..427726
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  BSK2_RS02125 (BSK2_02125) yclJ 419218..419901 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  BSK2_RS02130 (BSK2_02130) yclK 419888..421309 (+) 1422 WP_080528922.1 two-component system sensor histidine kinase YclK -
  BSK2_RS02135 (BSK2_02135) rapC 421472..422620 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  BSK2_RS02140 (BSK2_02140) phrC 422604..422726 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  BSK2_RS02145 (BSK2_02145) yczM 422826..422915 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  BSK2_RS02150 (BSK2_02150) yczN 422997..423110 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  BSK2_RS02155 (BSK2_02155) thrD 423264..424628 (-) 1365 WP_003234493.1 aspartate kinase -
  BSK2_RS02160 (BSK2_02160) ceuB 425013..425963 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  BSK2_RS02165 (BSK2_02165) yclO 425956..426903 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  BSK2_RS02170 (BSK2_02170) yclP 426897..427655 (+) 759 WP_046664285.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=185299 BSK2_RS02140 WP_003224994.1 422604..422726(+) (phrC) [Bacillus subtilis strain GQJK2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=185299 BSK2_RS02140 WP_003224994.1 422604..422726(+) (phrC) [Bacillus subtilis strain GQJK2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1