Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   LLUC109_RS10520 Genome accession   NZ_CP015907
Coordinates   2060169..2060405 (-) Length   78 a.a.
NCBI ID   WP_014573335.1    Uniprot ID   -
Organism   Lactococcus cremoris strain UC109     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2055169..2065405
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  LLUC109_RS10490 (LLUC109_2114) - 2056363..2057172 (-) 810 WP_011677177.1 metal ABC transporter permease -
  LLUC109_RS10495 (LLUC109_2115) - 2057165..2057902 (-) 738 WP_015082929.1 metal ABC transporter ATP-binding protein -
  LLUC109_RS10500 (LLUC109_2116) - 2058081..2058923 (-) 843 WP_011677179.1 metal ABC transporter solute-binding protein, Zn/Mn family -
  LLUC109_RS10505 (LLUC109_2117) - 2058920..2059357 (-) 438 WP_011677180.1 zinc-dependent MarR family transcriptional regulator -
  LLUC109_RS10510 (LLUC109_03085) comGG 2059437..2059736 (-) 300 WP_011677181.1 competence type IV pilus minor pilin ComGG Machinery gene
  LLUC109_RS10515 (LLUC109_2119) comGF 2059760..2060185 (-) 426 WP_373467301.1 competence type IV pilus minor pilin ComGF Machinery gene
  LLUC109_RS10520 (LLUC109_2120) comGE 2060169..2060405 (-) 237 WP_014573335.1 competence type IV pilus minor pilin ComGE Machinery gene
  LLUC109_RS10525 (LLUC109_03090) comGD 2060437..2060625 (-) 189 WP_014573336.1 hypothetical protein Machinery gene
  LLUC109_RS10530 (LLUC109_2122) comGC 2060827..2061177 (-) 351 WP_051013201.1 competence type IV pilus major pilin ComGC Machinery gene
  LLUC109_RS10535 (LLUC109_2123) comGB 2061222..2062247 (-) 1026 WP_051013189.1 competence type IV pilus assembly protein ComGB Machinery gene
  LLUC109_RS10540 (LLUC109_2124) comGA 2062147..2063127 (-) 981 WP_015082934.1 competence type IV pilus ATPase ComGA Machinery gene

Sequence

Protein


Download         Length: 78 a.a.        Molecular weight: 8700.94 Da        Isoelectric Point: 4.3885

>NTDB_id=183338 LLUC109_RS10520 WP_014573335.1 2060169..2060405(-) (comGE) [Lactococcus cremoris strain UC109]
MALLSFLVTFLLSALTNSRQQEVQENQQIESLNVAQMAIESQLMELSLNGSVIKIRQDSTATIISDHGKEILRLEAQN

Nucleotide


Download         Length: 237 bp        

>NTDB_id=183338 LLUC109_RS10520 WP_014573335.1 2060169..2060405(-) (comGE) [Lactococcus cremoris strain UC109]
ATGGCATTATTGAGCTTTTTGGTCACTTTTCTCTTAAGTGCTCTTACTAATTCTCGTCAGCAAGAGGTACAAGAAAATCA
ACAAATTGAGTCCTTAAATGTAGCTCAGATGGCAATAGAAAGTCAGCTGATGGAACTATCGTTAAATGGTTCTGTTATAA
AAATAAGACAAGATTCGACTGCAACCATTATTAGTGACCATGGAAAGGAAATTTTGCGACTTGAAGCTCAAAATTAG

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(1-74)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

96.154

100

0.962

Multiple sequence alignment