Detailed information
Bioinformatically predicted
Overview
| Name | comC/blpC | Type | Regulator |
| Locus tag | APQ13_RS08950 | Genome accession | NZ_CP013237 |
| Coordinates | 1848357..1848497 (-) | Length | 46 a.a. |
| NCBI ID | WP_002267610.1 | Uniprot ID | Q99QI5 |
| Organism | Streptococcus mutans strain NG8 isolate Dental Plaque | ||
| Function | binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology) Competence regulation |
||
Genomic Context
Location: 1843357..1853497
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| APQ13_RS08930 (APQ13_08910) | - | 1844357..1844983 (+) | 627 | WP_002266898.1 | hypothetical protein | - |
| APQ13_RS08935 (APQ13_08915) | - | 1845031..1845669 (+) | 639 | WP_002262115.1 | VTT domain-containing protein | - |
| APQ13_RS08940 (APQ13_08920) | comE/blpR | 1846141..1846893 (+) | 753 | WP_002262114.1 | response regulator transcription factor | Regulator |
| APQ13_RS08945 (APQ13_08925) | comD/blpH | 1846890..1848215 (+) | 1326 | WP_002289696.1 | sensor histidine kinase | Regulator |
| APQ13_RS08950 (APQ13_08930) | comC/blpC | 1848357..1848497 (-) | 141 | WP_002267610.1 | ComC/BlpC family leader-containing pheromone/bacteriocin | Regulator |
| APQ13_RS08955 (APQ13_08935) | cipB | 1848764..1848994 (+) | 231 | WP_002265368.1 | Blp family class II bacteriocin | Regulator |
| APQ13_RS08960 (APQ13_08940) | - | 1849125..1849526 (+) | 402 | WP_002310604.1 | hypothetical protein | - |
| APQ13_RS08965 (APQ13_08945) | - | 1850900..1851319 (+) | 420 | WP_002263913.1 | hypothetical protein | - |
| APQ13_RS08970 (APQ13_08950) | - | 1851466..1851870 (+) | 405 | WP_002263912.1 | hypothetical protein | - |
| APQ13_RS10430 | - | 1851993..1852205 (-) | 213 | Protein_1746 | IS3 family transposase | - |
| APQ13_RS10095 | - | 1852645..1852809 (+) | 165 | WP_002265308.1 | hypothetical protein | - |
| APQ13_RS08980 (APQ13_08960) | - | 1853214..1853426 (+) | 213 | WP_002263744.1 | Blp family class II bacteriocin | - |
Sequence
Protein
Download Length: 46 a.a. Molecular weight: 5211.06 Da Isoelectric Point: 10.4929
>NTDB_id=161020 APQ13_RS08950 WP_002267610.1 1848357..1848497(-) (comC/blpC) [Streptococcus mutans strain NG8 isolate Dental Plaque]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK
Nucleotide
Download Length: 141 bp
>NTDB_id=161020 APQ13_RS08950 WP_002267610.1 1848357..1848497(-) (comC/blpC) [Streptococcus mutans strain NG8 isolate Dental Plaque]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| comC/blpC | Streptococcus mutans UA159 |
100 |
100 |
1 |