Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   OB04_RS01980 Genome accession   NZ_CP009796
Coordinates   388506..388628 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain SG6     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 383506..393628
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  OB04_RS01965 (OB04_00382) yclJ 385119..385802 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  OB04_RS01970 (OB04_00383) yclK 385789..387210 (+) 1422 WP_082098066.1 two-component system sensor histidine kinase YclK -
  OB04_RS01975 (OB04_00384) rapC 387374..388522 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  OB04_RS01980 (OB04_00385) phrC 388506..388628 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  OB04_RS21215 (OB04_00386) yczM 388728..388817 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  OB04_RS21220 (OB04_00387) yczN 388899..389012 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  OB04_RS01995 (OB04_00388) thrD 389166..390530 (-) 1365 WP_038428355.1 aspartate kinase -
  OB04_RS02000 (OB04_00389) ceuB 390915..391865 (+) 951 WP_038428356.1 petrobactin ABC transporter permease YclN Machinery gene
  OB04_RS02005 (OB04_00390) yclO 391858..392805 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  OB04_RS02010 (OB04_00391) yclP 392799..393557 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=132306 OB04_RS01980 WP_003224994.1 388506..388628(+) (phrC) [Bacillus subtilis strain SG6]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=132306 OB04_RS01980 WP_003224994.1 388506..388628(+) (phrC) [Bacillus subtilis strain SG6]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment