Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | AMD19_RS16840 | Genome accession | NZ_CP008992 |
| Coordinates | 3792310..3792429 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri subsp. citri UI6 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3771582..3792081 | 3792310..3792429 | flank | 229 |
Gene organization within MGE regions
Location: 3771582..3792429
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| AMD19_RS23830 (J158_03387) | - | 3771582..3772749 (+) | 1168 | Protein_3189 | IS3 family transposase | - |
| AMD19_RS16760 (J158_03389) | avrXacE2 | 3773509..3774579 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| AMD19_RS16765 (J158_03390) | - | 3774664..3775941 (-) | 1278 | WP_011052115.1 | lytic murein transglycosylase | - |
| AMD19_RS16770 (J158_03391) | - | 3776074..3779064 (-) | 2991 | WP_045713603.1 | Tn3-like element TnXax1 family transposase | - |
| AMD19_RS16775 (J158_03392) | - | 3779073..3780347 (-) | 1275 | Protein_3193 | site-specific integrase | - |
| AMD19_RS16785 (J158_03394) | - | 3780540..3781616 (+) | 1077 | WP_011052118.1 | DNA-binding protein | - |
| AMD19_RS16790 (J158_03395) | xopAI | 3781750..3782640 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| AMD19_RS16800 (J158_03397) | - | 3783971..3784255 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| AMD19_RS16805 (J158_03398) | - | 3784483..3785598 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| AMD19_RS16810 (J158_03399) | - | 3785553..3786068 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| AMD19_RS16815 (J158_03400) | sucD | 3786155..3787030 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| AMD19_RS16820 (J158_03401) | sucC | 3787055..3788224 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| AMD19_RS16825 (J158_03402) | - | 3788456..3790069 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| AMD19_RS16830 (J158_03403) | pilR | 3790394..3791788 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| AMD19_RS16835 (J158_03405) | - | 3792011..3792178 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| AMD19_RS16840 (J158_03406) | pilB | 3792310..3792429 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=125976 AMD19_RS16840 WP_005915819.1 3792310..3792429(-) (pilB) [Xanthomonas citri subsp. citri UI6]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=125976 AMD19_RS16840 WP_005915819.1 3792310..3792429(-) (pilB) [Xanthomonas citri subsp. citri UI6]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |