Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   AW03_RS02025 Genome accession   NZ_CP007173
Coordinates   405047..405169 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis HJ5     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 400047..410169
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AW03_RS02010 (AW03_003710) yclJ 401660..402343 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  AW03_RS02015 (AW03_003720) yclK 402330..403751 (+) 1422 WP_080030630.1 two-component system sensor histidine kinase YclK -
  AW03_RS02020 (AW03_003730) rapC 403915..405063 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  AW03_RS02025 (AW03_003740) phrC 405047..405169 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AW03_RS20720 yczM 405269..405358 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  AW03_RS20725 (AW03_003750) yczN 405440..405553 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  AW03_RS02040 (AW03_003760) thrD 405706..407070 (-) 1365 WP_015382767.1 aspartate kinase -
  AW03_RS02045 (AW03_003770) ceuB 407455..408405 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  AW03_RS02050 (AW03_003780) yclO 408398..409345 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  AW03_RS02055 (AW03_003790) yclP 409339..410097 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=117017 AW03_RS02025 WP_003224994.1 405047..405169(+) (phrC) [Bacillus subtilis HJ5]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=117017 AW03_RS02025 WP_003224994.1 405047..405169(+) (phrC) [Bacillus subtilis HJ5]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment