Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   KJP56_RS02510 Genome accession   NZ_OX419652
Coordinates   475941..476063 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis isolate NRS6131     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 470941..481063
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  KJP56_RS02495 (NRS6131_02510) yclJ 472555..473238 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  KJP56_RS02500 (NRS6131_02515) yclK 473225..474646 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  KJP56_RS02505 (NRS6131_02520) rapC 474809..475957 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  KJP56_RS02510 (NRS6131_02525) phrC 475941..476063 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  KJP56_RS02515 (NRS6131_02530) yczM 476163..476252 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  KJP56_RS02520 (NRS6131_02535) yczN 476334..476447 (-) 114 WP_032678937.1 YjcZ family sporulation protein -
  KJP56_RS02525 (NRS6131_02540) thrD 476600..477964 (-) 1365 WP_072173982.1 aspartate kinase -
  KJP56_RS02530 (NRS6131_02545) ceuB 478349..479299 (+) 951 WP_015382768.1 petrobactin ABC transporter permease YclN Machinery gene
  KJP56_RS02535 (NRS6131_02550) yclO 479292..480239 (+) 948 WP_014475805.1 petrobactin ABC transporter permease YclO -
  KJP56_RS02540 (NRS6131_02555) yclP 480233..480991 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1158039 KJP56_RS02510 WP_003224994.1 475941..476063(+) (phrC) [Bacillus subtilis isolate NRS6131]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1158039 KJP56_RS02510 WP_003224994.1 475941..476063(+) (phrC) [Bacillus subtilis isolate NRS6131]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment