Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | J151_RS16935 | Genome accession | NZ_CP006857 |
| Coordinates | 3816626..3816745 (-) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri subsp. citri A306 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 3795898..3816397 | 3816626..3816745 | flank | 229 |
Gene organization within MGE regions
Location: 3795898..3816745
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| J151_RS24165 (J151_03408) | - | 3795898..3797065 (+) | 1168 | Protein_3215 | IS3 family transposase | - |
| J151_RS16855 (J151_03410) | avrXacE2 | 3797825..3798895 (-) | 1071 | WP_011052114.1 | type III secretion system effector avirulence protein AvrXacE2 | - |
| J151_RS16860 (J151_03411) | - | 3798980..3800257 (-) | 1278 | WP_011052115.1 | lytic murein transglycosylase | - |
| J151_RS16865 (J151_03412) | - | 3800390..3803380 (-) | 2991 | WP_040107658.1 | Tn3-like element TnXax1 family transposase | - |
| J151_RS16870 (J151_03413) | - | 3803389..3804663 (-) | 1275 | Protein_3219 | site-specific integrase | - |
| J151_RS16880 (J151_03415) | - | 3804856..3805932 (+) | 1077 | WP_011052118.1 | DNA-binding protein | - |
| J151_RS16885 (J151_03416) | xopAI | 3806066..3806956 (+) | 891 | WP_011052119.1 | type III secretion system effector XopAI | - |
| J151_RS16890 (J151_03417) | - | 3807376..3808182 (-) | 807 | WP_015463520.1 | hypothetical protein | - |
| J151_RS16895 (J151_03418) | - | 3808287..3808571 (+) | 285 | WP_016849322.1 | hypothetical protein | - |
| J151_RS16900 (J151_03419) | - | 3808799..3809914 (+) | 1116 | WP_011052122.1 | IS1595 family transposase | - |
| J151_RS16905 (J151_03420) | - | 3809869..3810384 (-) | 516 | WP_011052123.1 | hypothetical protein | - |
| J151_RS16910 (J151_03421) | sucD | 3810471..3811346 (-) | 876 | WP_005921370.1 | succinate--CoA ligase subunit alpha | - |
| J151_RS16915 (J151_03422) | sucC | 3811371..3812540 (-) | 1170 | WP_005915812.1 | ADP-forming succinate--CoA ligase subunit beta | - |
| J151_RS16920 (J151_03423) | - | 3812772..3814385 (+) | 1614 | WP_003488599.1 | HAMP domain-containing sensor histidine kinase | - |
| J151_RS16925 (J151_03424) | pilR | 3814710..3816104 (+) | 1395 | WP_015463522.1 | sigma-54 dependent transcriptional regulator | Regulator |
| J151_RS16930 (J151_03426) | - | 3816327..3816494 (-) | 168 | WP_015463523.1 | hypothetical protein | - |
| J151_RS16935 (J151_03427) | pilB | 3816626..3816745 (-) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=114457 J151_RS16935 WP_005915819.1 3816626..3816745(-) (pilB) [Xanthomonas citri subsp. citri A306]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=114457 J151_RS16935 WP_005915819.1 3816626..3816745(-) (pilB) [Xanthomonas citri subsp. citri A306]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |