Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABFT42_RS02165 Genome accession   NZ_CP178596
Coordinates   426166..426288 (+) Length   40 a.a.
NCBI ID   WP_010333023.1    Uniprot ID   Q6B9X2
Organism   Bacillus mojavensis strain C3     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 421166..431288
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABFT42_RS02150 (ABFT42_02150) yclJ 422771..423454 (+) 684 WP_010333020.1 two-component system response regulator YclJ -
  ABFT42_RS02155 (ABFT42_02155) - 423441..424856 (+) 1416 WP_326217671.1 HAMP domain-containing sensor histidine kinase -
  ABFT42_RS02160 (ABFT42_02160) rapC 425034..426182 (+) 1149 WP_168746930.1 response regulator aspartate phosphatase RapC Regulator
  ABFT42_RS02165 (ABFT42_02165) phrC 426166..426288 (+) 123 WP_010333023.1 PhrC/PhrF family phosphatase-inhibitory pheromone Regulator
  ABFT42_RS02170 (ABFT42_02170) - 426393..426485 (-) 93 WP_026014660.1 YjcZ family sporulation protein -
  ABFT42_RS02175 (ABFT42_02175) - 426633..426737 (-) 105 WP_268444540.1 sporulation protein YjcZ -
  ABFT42_RS02180 (ABFT42_02180) - 426857..428221 (-) 1365 WP_010333024.1 aspartate kinase -
  ABFT42_RS02185 (ABFT42_02185) ceuB 428607..429557 (+) 951 WP_413286913.1 petrobactin ABC transporter permease YclN Machinery gene
  ABFT42_RS02190 (ABFT42_02190) yclO 429550..430497 (+) 948 WP_010333026.1 petrobactin ABC transporter permease YclO -
  ABFT42_RS02195 (ABFT42_02195) yclP 430491..431249 (+) 759 WP_229149899.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4208.97 Da        Isoelectric Point: 8.0579

>NTDB_id=1090284 ABFT42_RS02165 WP_010333023.1 426166..426288(+) (phrC) [Bacillus mojavensis strain C3]
MKLKSKLFVICLAAAAVFTAVGVSAHAEASDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1090284 ABFT42_RS02165 WP_010333023.1 426166..426288(+) (phrC) [Bacillus mojavensis strain C3]
ATGAAATTGAAATCTAAGTTATTTGTTATTTGTTTGGCTGCAGCAGCTGTTTTTACAGCGGTTGGCGTCTCTGCACATGC
TGAAGCATCCGACTTCCATGTCACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB Q6B9X2

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

90

100

0.9

Multiple sequence alignment