Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   ACEY2B_RS00885 Genome accession   NZ_CP169315
Coordinates   180037..180333 (+) Length   98 a.a.
NCBI ID   WP_015427164.1    Uniprot ID   -
Organism   Lactococcus lactis strain IFLLLBEK1     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 175037..185333
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACEY2B_RS00860 (ACEY2B_00860) - 176146..177102 (+) 957 WP_052312061.1 hypothetical protein -
  ACEY2B_RS00865 (ACEY2B_00865) comGA 177372..178310 (+) 939 WP_015427168.1 competence type IV pilus ATPase ComGA Machinery gene
  ACEY2B_RS00870 (ACEY2B_00870) comGB 178204..179277 (+) 1074 WP_080619357.1 competence type IV pilus assembly protein ComGB Machinery gene
  ACEY2B_RS00875 (ACEY2B_00875) comGC 179291..179674 (+) 384 WP_015427166.1 competence type IV pilus major pilin ComGC Machinery gene
  ACEY2B_RS00880 (ACEY2B_00880) comGD 179634..180065 (+) 432 WP_015427165.1 competence type IV pilus minor pilin ComGD Machinery gene
  ACEY2B_RS00885 (ACEY2B_00885) comGE 180037..180333 (+) 297 WP_015427164.1 competence type IV pilus minor pilin ComGE Machinery gene
  ACEY2B_RS00890 (ACEY2B_00890) comGF 180296..180742 (+) 447 WP_042230641.1 competence type IV pilus minor pilin ComGF Machinery gene
  ACEY2B_RS00895 (ACEY2B_00895) comGG 180790..181065 (+) 276 WP_374788292.1 hypothetical protein Machinery gene
  ACEY2B_RS00900 (ACEY2B_00900) - 181147..181584 (+) 438 WP_136122555.1 zinc-dependent MarR family transcriptional regulator -
  ACEY2B_RS00905 (ACEY2B_00905) - 181581..182423 (+) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  ACEY2B_RS00910 (ACEY2B_00910) - 182600..183337 (+) 738 WP_015427159.1 metal ABC transporter ATP-binding protein -
  ACEY2B_RS00915 (ACEY2B_00915) - 183330..184139 (+) 810 WP_015427158.1 metal ABC transporter permease -
  ACEY2B_RS00920 (ACEY2B_00920) - 184177..185043 (-) 867 WP_042230639.1 RluA family pseudouridine synthase -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11090.98 Da        Isoelectric Point: 6.4684

>NTDB_id=1050460 ACEY2B_RS00885 WP_015427164.1 180037..180333(+) (comGE) [Lactococcus lactis strain IFLLLBEK1]
MENLKRKSVKAYLLLESLISIALLAFLVSFILSSLVQVRQKDTEENQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMRLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=1050460 ACEY2B_RS00885 WP_015427164.1 180037..180333(+) (comGE) [Lactococcus lactis strain IFLLLBEK1]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCTTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAAATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCAGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCGACTTGAACTTCAAAGTTAA

Domains

Predicted by InterproScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

69.072

98.98

0.684

Multiple sequence alignment