Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACCQ05_RS05475 | Genome accession | NZ_CP167846 |
| Coordinates | 1298744..1298863 (+) | Length | 39 a.a. |
| NCBI ID | WP_372393161.1 | Uniprot ID | - |
| Organism | Xanthomonas sp. NCPPB 3582 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Related MGE
Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.
Gene-MGE association summary
| MGE type | MGE coordinates | Gene coordinates | Relative position | Distance (bp) |
|---|---|---|---|---|
| Genomic island | 1274558..1300646 | 1298744..1298863 | within | 0 |
Gene organization within MGE regions
Location: 1274558..1300646
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACCQ05_RS05370 (ACCQ05_05370) | - | 1274716..1275108 (+) | 393 | WP_104539086.1 | hypothetical protein | - |
| ACCQ05_RS05375 (ACCQ05_05375) | - | 1275197..1275589 (+) | 393 | WP_064511049.1 | H-NS family nucleoid-associated regulatory protein | - |
| ACCQ05_RS05380 (ACCQ05_05380) | glgX | 1276099..1278231 (-) | 2133 | WP_372393148.1 | glycogen debranching protein GlgX | - |
| ACCQ05_RS05385 (ACCQ05_05385) | rimK | 1278688..1279605 (+) | 918 | WP_372393149.1 | 30S ribosomal protein S6--L-glutamate ligase | - |
| ACCQ05_RS05390 (ACCQ05_05390) | - | 1279697..1280281 (+) | 585 | WP_372393150.1 | hypothetical protein | - |
| ACCQ05_RS05395 (ACCQ05_05395) | - | 1280300..1280977 (+) | 678 | WP_003490678.1 | response regulator transcription factor | - |
| ACCQ05_RS05400 (ACCQ05_05400) | - | 1280970..1282304 (+) | 1335 | WP_372393151.1 | sensor histidine kinase | - |
| ACCQ05_RS05405 (ACCQ05_05405) | - | 1282490..1282575 (+) | 86 | Protein_1041 | IS5/IS1182 family transposase | - |
| ACCQ05_RS05410 (ACCQ05_05410) | - | 1282627..1282839 (-) | 213 | WP_372393152.1 | hypothetical protein | - |
| ACCQ05_RS05415 (ACCQ05_05415) | - | 1282841..1284183 (-) | 1343 | Protein_1043 | RHS repeat-associated core domain-containing protein | - |
| ACCQ05_RS05420 (ACCQ05_05420) | - | 1284198..1284701 (-) | 504 | WP_372393154.1 | hypothetical protein | - |
| ACCQ05_RS05425 (ACCQ05_05425) | - | 1284691..1286283 (-) | 1593 | Protein_1045 | RHS repeat domain-containing protein | - |
| ACCQ05_RS05430 (ACCQ05_05430) | - | 1286285..1286608 (-) | 324 | WP_372393155.1 | hypothetical protein | - |
| ACCQ05_RS05435 (ACCQ05_05435) | - | 1286605..1291161 (-) | 4557 | WP_372393156.1 | DUF4329 domain-containing protein | - |
| ACCQ05_RS05440 (ACCQ05_05440) | coaE | 1291380..1292021 (-) | 642 | WP_228963906.1 | dephospho-CoA kinase | - |
| ACCQ05_RS05445 (ACCQ05_05445) | - | 1292035..1292898 (-) | 864 | WP_338339698.1 | A24 family peptidase | - |
| ACCQ05_RS05450 (ACCQ05_05450) | pilC | 1292905..1294161 (-) | 1257 | WP_372393157.1 | type II secretion system F family protein | Machinery gene |
| ACCQ05_RS05455 (ACCQ05_05455) | - | 1294593..1295054 (+) | 462 | WP_372393158.1 | pilin | - |
| ACCQ05_RS05460 (ACCQ05_05460) | - | 1295129..1295758 (+) | 630 | WP_372393159.1 | isoprenylcysteine carboxylmethyltransferase family protein | - |
| ACCQ05_RS05465 (ACCQ05_05465) | - | 1295797..1296888 (+) | 1092 | WP_372393160.1 | hypothetical protein | - |
| ACCQ05_RS05470 (ACCQ05_05470) | pilB | 1296969..1298678 (+) | 1710 | WP_372393943.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACCQ05_RS05475 (ACCQ05_05475) | pilB | 1298744..1298863 (+) | 120 | WP_372393161.1 | pilus assembly protein | Machinery gene |
| ACCQ05_RS05480 (ACCQ05_05480) | - | 1300272..1300633 (+) | 362 | Protein_1056 | transposase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4207.88 Da Isoelectric Point: 10.4810
>NTDB_id=1039793 ACCQ05_RS05475 WP_372393161.1 1298744..1298863(+) (pilB) [Xanthomonas sp. NCPPB 3582]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLGEINRVSKD
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLGEINRVSKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1039793 ACCQ05_RS05475 WP_372393161.1 1298744..1298863(+) (pilB) [Xanthomonas sp. NCPPB 3582]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGCATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGGCGAGATCAATCGGGTGTCCAAGGACTAG
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGCATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGGCGAGATCAATCGGGTGTCCAAGGACTAG
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |