Detailed information    

insolico Bioinformatically predicted

Overview

Name   pilB   Type   Machinery gene
Locus tag   ACCQ05_RS05475 Genome accession   NZ_CP167846
Coordinates   1298744..1298863 (+) Length   39 a.a.
NCBI ID   WP_372393161.1    Uniprot ID   -
Organism   Xanthomonas sp. NCPPB 3582     
Function   power the assembly of type IV pilus (predicted from homology)   
DNA binding and uptake

Related MGE

Note: This gene co-localizes with putative mobile genetic elements (MGEs) in the genome predicted by VRprofile2, as detailed below.

Gene-MGE association summary

MGE type MGE coordinates Gene coordinates Relative position Distance (bp)
Genomic island 1274558..1300646 1298744..1298863 within 0


Gene organization within MGE regions


Location: 1274558..1300646
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACCQ05_RS05370 (ACCQ05_05370) - 1274716..1275108 (+) 393 WP_104539086.1 hypothetical protein -
  ACCQ05_RS05375 (ACCQ05_05375) - 1275197..1275589 (+) 393 WP_064511049.1 H-NS family nucleoid-associated regulatory protein -
  ACCQ05_RS05380 (ACCQ05_05380) glgX 1276099..1278231 (-) 2133 WP_372393148.1 glycogen debranching protein GlgX -
  ACCQ05_RS05385 (ACCQ05_05385) rimK 1278688..1279605 (+) 918 WP_372393149.1 30S ribosomal protein S6--L-glutamate ligase -
  ACCQ05_RS05390 (ACCQ05_05390) - 1279697..1280281 (+) 585 WP_372393150.1 hypothetical protein -
  ACCQ05_RS05395 (ACCQ05_05395) - 1280300..1280977 (+) 678 WP_003490678.1 response regulator transcription factor -
  ACCQ05_RS05400 (ACCQ05_05400) - 1280970..1282304 (+) 1335 WP_372393151.1 sensor histidine kinase -
  ACCQ05_RS05405 (ACCQ05_05405) - 1282490..1282575 (+) 86 Protein_1041 IS5/IS1182 family transposase -
  ACCQ05_RS05410 (ACCQ05_05410) - 1282627..1282839 (-) 213 WP_372393152.1 hypothetical protein -
  ACCQ05_RS05415 (ACCQ05_05415) - 1282841..1284183 (-) 1343 Protein_1043 RHS repeat-associated core domain-containing protein -
  ACCQ05_RS05420 (ACCQ05_05420) - 1284198..1284701 (-) 504 WP_372393154.1 hypothetical protein -
  ACCQ05_RS05425 (ACCQ05_05425) - 1284691..1286283 (-) 1593 Protein_1045 RHS repeat domain-containing protein -
  ACCQ05_RS05430 (ACCQ05_05430) - 1286285..1286608 (-) 324 WP_372393155.1 hypothetical protein -
  ACCQ05_RS05435 (ACCQ05_05435) - 1286605..1291161 (-) 4557 WP_372393156.1 DUF4329 domain-containing protein -
  ACCQ05_RS05440 (ACCQ05_05440) coaE 1291380..1292021 (-) 642 WP_228963906.1 dephospho-CoA kinase -
  ACCQ05_RS05445 (ACCQ05_05445) - 1292035..1292898 (-) 864 WP_338339698.1 A24 family peptidase -
  ACCQ05_RS05450 (ACCQ05_05450) pilC 1292905..1294161 (-) 1257 WP_372393157.1 type II secretion system F family protein Machinery gene
  ACCQ05_RS05455 (ACCQ05_05455) - 1294593..1295054 (+) 462 WP_372393158.1 pilin -
  ACCQ05_RS05460 (ACCQ05_05460) - 1295129..1295758 (+) 630 WP_372393159.1 isoprenylcysteine carboxylmethyltransferase family protein -
  ACCQ05_RS05465 (ACCQ05_05465) - 1295797..1296888 (+) 1092 WP_372393160.1 hypothetical protein -
  ACCQ05_RS05470 (ACCQ05_05470) pilB 1296969..1298678 (+) 1710 WP_372393943.1 type IV-A pilus assembly ATPase PilB Machinery gene
  ACCQ05_RS05475 (ACCQ05_05475) pilB 1298744..1298863 (+) 120 WP_372393161.1 pilus assembly protein Machinery gene
  ACCQ05_RS05480 (ACCQ05_05480) - 1300272..1300633 (+) 362 Protein_1056 transposase -

Sequence

Protein


Download         Length: 39 a.a.        Molecular weight: 4207.88 Da        Isoelectric Point: 10.4810

>NTDB_id=1039793 ACCQ05_RS05475 WP_372393161.1 1298744..1298863(+) (pilB) [Xanthomonas sp. NCPPB 3582]
MQIAEAAQKIGIRDLRQSALMKAAHGVTSLGEINRVSKD

Nucleotide


Download         Length: 120 bp        

>NTDB_id=1039793 ACCQ05_RS05475 WP_372393161.1 1298744..1298863(+) (pilB) [Xanthomonas sp. NCPPB 3582]
ATGCAGATCGCCGAGGCGGCGCAGAAGATCGGCATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCATGGGGT
GACCAGCCTGGGCGAGATCAATCGGGTGTCCAAGGACTAG

Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  pilB Acinetobacter baumannii D1279779

48.718

100

0.487
  pilB Acinetobacter baylyi ADP1

48.718

100

0.487

Multiple sequence alignment