Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ACCQ18_RS05745 | Genome accession | NZ_CP167830 |
| Coordinates | 1265851..1265970 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas axonopodis pv. desmodiilaxiflori strain NCPPB 3086 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1260851..1270970
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ACCQ18_RS05720 (ACCQ18_05715) | - | 1261145..1261429 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| ACCQ18_RS05725 (ACCQ18_05720) | - | 1261434..1262228 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| ACCQ18_RS05730 (ACCQ18_05725) | - | 1262243..1263271 (+) | 1029 | WP_234787234.1 | glycosyltransferase | - |
| ACCQ18_RS05735 (ACCQ18_05730) | - | 1263264..1263920 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| ACCQ18_RS05740 (ACCQ18_05735) | pilB | 1264018..1265754 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ACCQ18_RS05745 (ACCQ18_05740) | pilB | 1265851..1265970 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| ACCQ18_RS05750 (ACCQ18_05745) | - | 1266087..1266269 (+) | 183 | Protein_1125 | hypothetical protein | - |
| ACCQ18_RS05755 (ACCQ18_05750) | pilR | 1266456..1267910 (-) | 1455 | WP_033481907.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ACCQ18_RS05760 (ACCQ18_05755) | - | 1268175..1269788 (-) | 1614 | WP_005915814.1 | PAS domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=1039666 ACCQ18_RS05745 WP_005915819.1 1265851..1265970(+) (pilB) [Xanthomonas axonopodis pv. desmodiilaxiflori strain NCPPB 3086]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1039666 ACCQ18_RS05745 WP_005915819.1 1265851..1265970(+) (pilB) [Xanthomonas axonopodis pv. desmodiilaxiflori strain NCPPB 3086]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |