Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABZM97_RS02215 Genome accession   NZ_CP160797
Coordinates   437734..437856 (+) Length   40 a.a.
NCBI ID   WP_087993038.1    Uniprot ID   -
Organism   Bacillus vallismortis strain BL-01     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 432734..442856
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABZM97_RS02200 (ABZM97_02200) yclJ 434354..435037 (+) 684 WP_087993041.1 two-component system response regulator YclJ -
  ABZM97_RS02205 (ABZM97_02205) - 435024..436439 (+) 1416 WP_087993040.1 HAMP domain-containing sensor histidine kinase -
  ABZM97_RS02210 (ABZM97_02210) rapC 436602..437750 (+) 1149 WP_087993039.1 response regulator aspartate phosphatase RapC Regulator
  ABZM97_RS02215 (ABZM97_02215) phrC 437734..437856 (+) 123 WP_087993038.1 phosphatase RapC inhibitor PhrC Regulator
  ABZM97_RS02220 (ABZM97_02220) - 437956..438051 (-) 96 WP_148962990.1 YjcZ family sporulation protein -
  ABZM97_RS02225 (ABZM97_02225) - 438188..438301 (-) 114 WP_039075856.1 YjcZ family sporulation protein -
  ABZM97_RS02230 (ABZM97_02230) - 438452..439816 (-) 1365 WP_087993036.1 aspartate kinase -
  ABZM97_RS02235 (ABZM97_02235) ceuB 440203..441153 (+) 951 WP_087993035.1 petrobactin ABC transporter permease YclN Machinery gene
  ABZM97_RS02240 (ABZM97_02240) yclO 441146..442093 (+) 948 WP_367387162.1 petrobactin ABC transporter permease YclO -
  ABZM97_RS02245 (ABZM97_02245) yclP 442087..442845 (+) 759 WP_087993033.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4167.96 Da        Isoelectric Point: 8.0285

>NTDB_id=1022001 ABZM97_RS02215 WP_087993038.1 437734..437856(+) (phrC) [Bacillus vallismortis strain BL-01]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVAERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1022001 ABZM97_RS02215 WP_087993038.1 437734..437856(+) (phrC) [Bacillus vallismortis strain BL-01]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTAGCCGCGGCTGCAATTTTTACAGCGGCTGGCGTCTCAGCTAACGC
GGAAGCACTCGACTTTCATGTGGCGGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment