Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   AB0R82_RS02130 Genome accession   NZ_CP160220
Coordinates   419495..419617 (+) Length   40 a.a.
NCBI ID   WP_198878977.1    Uniprot ID   -
Organism   Bacillus subtilis strain JM553     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 414495..424617
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB0R82_RS02115 (AB0R82_02115) yclJ 416108..416791 (+) 684 WP_204551422.1 response regulator transcription factor -
  AB0R82_RS02120 (AB0R82_02120) yclK 416778..418199 (+) 1422 WP_086343454.1 two-component system sensor histidine kinase YclK -
  AB0R82_RS02125 (AB0R82_02125) rapC 418363..419511 (+) 1149 WP_366592180.1 response regulator aspartate phosphatase RapC Regulator
  AB0R82_RS02130 (AB0R82_02130) phrC 419495..419617 (+) 123 WP_198878977.1 phosphatase RapC inhibitor PhrC Regulator
  AB0R82_RS02135 (AB0R82_02135) yczM 419717..419806 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  AB0R82_RS02140 (AB0R82_02140) yczN 419888..420001 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  AB0R82_RS02145 (AB0R82_02145) thrD 420154..421518 (-) 1365 WP_198878978.1 aspartate kinase -
  AB0R82_RS02150 (AB0R82_02150) ceuB 421903..422853 (+) 951 WP_088325307.1 petrobactin ABC transporter permease YclN Machinery gene
  AB0R82_RS02155 (AB0R82_02155) yclO 422846..423793 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AB0R82_RS02160 (AB0R82_02160) yclP 423787..424545 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4226.04 Da        Isoelectric Point: 8.0285

>NTDB_id=1019665 AB0R82_RS02130 WP_198878977.1 419495..419617(+) (phrC) [Bacillus subtilis strain JM553]
MKLKSKLFVICLAAAAIFTAAGVSANAEVLDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1019665 AB0R82_RS02130 WP_198878977.1 419495..419617(+) (phrC) [Bacillus subtilis strain JM553]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGTGCTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

97.5

100

0.975

Multiple sequence alignment