Detailed information    

insolico Bioinformatically predicted

Overview

Name   phrC   Type   Regulator
Locus tag   ABXV02_RS19750 Genome accession   NZ_CP159912
Coordinates   3767934..3768056 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain PY79     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context

Location: 3762934..3773056
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ABXV02_RS19720 yclP 3763005..3763763 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  ABXV02_RS19725 yclO 3763757..3764704 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ABXV02_RS19730 ceuB 3764697..3765647 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  ABXV02_RS19735 thrD 3766032..3767396 (+) 1365 WP_009966541.1 aspartate kinase -
  ABXV02_RS19740 yczN 3767550..3767663 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ABXV02_RS19745 yczM 3767745..3767834 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ABXV02_RS19750 phrC 3767934..3768056 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ABXV02_RS19755 rapC 3768040..3769188 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  ABXV02_RS19760 yclK 3769351..3770772 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  ABXV02_RS19765 yclJ 3770759..3771442 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence

Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=1016783 ABXV02_RS19750 WP_003224994.1 3767934..3768056(-) (phrC) [Bacillus subtilis strain PY79]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=1016783 ABXV02_RS19750 WP_003224994.1 3767934..3768056(-) (phrC) [Bacillus subtilis strain PY79]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA

Domains

Predicted by InterproScan.

Rap-phr extracellular signalling (PhrC_PhrF)

(3-40)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1

Multiple sequence alignment