Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ABLV33_RS05725 | Genome accession | NZ_CP157605 |
| Coordinates | 1265948..1266067 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. malvacearum strain Xcm TX4 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1260948..1271067
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABLV33_RS05700 (ABLV33_05700) | - | 1261242..1261526 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| ABLV33_RS05705 (ABLV33_05705) | - | 1261531..1262325 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| ABLV33_RS05710 (ABLV33_05710) | - | 1262328..1263368 (+) | 1041 | WP_050554799.1 | glycosyltransferase | - |
| ABLV33_RS05715 (ABLV33_05715) | - | 1263361..1264017 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| ABLV33_RS05720 (ABLV33_05720) | pilB | 1264115..1265851 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ABLV33_RS05725 (ABLV33_05725) | pilB | 1265948..1266067 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| ABLV33_RS05730 (ABLV33_05730) | - | 1266223..1266366 (+) | 144 | WP_005915817.1 | hypothetical protein | - |
| ABLV33_RS05735 (ABLV33_05735) | pilR | 1266553..1268007 (-) | 1455 | WP_033481907.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ABLV33_RS05740 (ABLV33_05740) | - | 1268272..1269885 (-) | 1614 | WP_005915814.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=1007634 ABLV33_RS05725 WP_005915819.1 1265948..1266067(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX4]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1007634 ABLV33_RS05725 WP_005915819.1 1265948..1266067(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX4]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |