Detailed information
Bioinformatically predicted
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ABLV34_RS05755 | Genome accession | NZ_CP157597 |
| Coordinates | 1271538..1271657 (+) | Length | 39 a.a. |
| NCBI ID | WP_005915819.1 | Uniprot ID | A0A7S6YV99 |
| Organism | Xanthomonas citri pv. malvacearum strain Xcm TX9 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 1266538..1276657
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABLV34_RS05725 (ABLV34_05725) | - | 1266831..1267115 (+) | 285 | WP_232515052.1 | SMR family transporter | - |
| ABLV34_RS05730 (ABLV34_05730) | - | 1267120..1267914 (+) | 795 | WP_005915828.1 | glycosyltransferase | - |
| ABLV34_RS05735 (ABLV34_05735) | - | 1267917..1268114 (+) | 198 | Protein_1122 | glycosyltransferase family 2 protein | - |
| ABLV34_RS05740 (ABLV34_05740) | - | 1268221..1268958 (+) | 738 | WP_350359749.1 | glycosyltransferase | - |
| ABLV34_RS05745 (ABLV34_05745) | - | 1268951..1269607 (+) | 657 | WP_157733690.1 | methionine biosynthesis protein MetW | - |
| ABLV34_RS05750 (ABLV34_05750) | pilB | 1269705..1271441 (+) | 1737 | WP_005915821.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ABLV34_RS05755 (ABLV34_05755) | pilB | 1271538..1271657 (+) | 120 | WP_005915819.1 | hypothetical protein | Machinery gene |
| ABLV34_RS05760 (ABLV34_05760) | - | 1271813..1271956 (+) | 144 | WP_005915817.1 | hypothetical protein | - |
| ABLV34_RS05765 (ABLV34_05765) | - | 1272143..1273598 (-) | 1456 | Protein_1128 | sigma-54 dependent transcriptional regulator | - |
| ABLV34_RS05770 (ABLV34_05770) | - | 1273863..1275476 (-) | 1614 | WP_005915814.1 | HAMP domain-containing sensor histidine kinase | - |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4178.84 Da Isoelectric Point: 9.0113
>NTDB_id=1007599 ABLV34_RS05755 WP_005915819.1 1271538..1271657(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX9]
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTSLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1007599 ABLV34_RS05755 WP_005915819.1 1271538..1271657(+) (pilB) [Xanthomonas citri pv. malvacearum strain Xcm TX9]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAGCCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
51.282 |
100 |
0.513 |
| pilB | Acinetobacter baumannii D1279779 |
48.718 |
100 |
0.487 |
| pilB | Vibrio cholerae strain A1552 |
45.714 |
89.744 |
0.41 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |