Detailed information
Overview
| Name | pilB | Type | Machinery gene |
| Locus tag | ABHI22_RS14260 | Genome accession | NZ_CP156909 |
| Coordinates | 3327252..3327371 (-) | Length | 39 a.a. |
| NCBI ID | WP_033482837.1 | Uniprot ID | - |
| Organism | Xanthomonas citri pv. mangiferaeindicae strain CFBP 9184 | ||
| Function | power the assembly of type IV pilus (predicted from homology) DNA binding and uptake |
||
Genomic Context
Location: 3322252..3332371
| Locus tag | Gene name | Coordinates (strand) | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ABHI22_RS14245 (ABHI22_14260) | - | 3323431..3325044 (+) | 1614 | WP_003488599.1 | PAS domain-containing sensor histidine kinase | - |
| ABHI22_RS14250 (ABHI22_14265) | pilR | 3325373..3326767 (+) | 1395 | WP_003488597.1 | sigma-54 dependent transcriptional regulator | Regulator |
| ABHI22_RS14255 (ABHI22_14270) | - | 3326965..3327120 (-) | 156 | WP_003488595.1 | hypothetical protein | - |
| ABHI22_RS14260 (ABHI22_14275) | pilB | 3327252..3327371 (-) | 120 | WP_033482837.1 | hypothetical protein | Machinery gene |
| ABHI22_RS14265 (ABHI22_14280) | pilB | 3327468..3329204 (-) | 1737 | WP_033482835.1 | type IV-A pilus assembly ATPase PilB | Machinery gene |
| ABHI22_RS14270 (ABHI22_14285) | pilA2 | 3329246..3329659 (-) | 414 | WP_005921365.1 | pilin | Machinery gene |
| ABHI22_RS14275 (ABHI22_14290) | comP | 3329756..3330184 (-) | 429 | WP_005921364.1 | pilin | Machinery gene |
| ABHI22_RS14280 (ABHI22_14295) | pilC | 3330529..3331788 (+) | 1260 | WP_033483308.1 | type II secretion system F family protein | Machinery gene |
Sequence
Protein
Download Length: 39 a.a. Molecular weight: 4205.86 Da Isoelectric Point: 9.0113
>NTDB_id=1003170 ABHI22_RS14260 WP_033482837.1 3327252..3327371(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain CFBP 9184]
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
MQIAEAAQAIGIRDLRQSALMKAAHGVTNLAEINRVTKD
Nucleotide
Download Length: 120 bp
>NTDB_id=1003170 ABHI22_RS14260 WP_033482837.1 3327252..3327371(-) (pilB) [Xanthomonas citri pv. mangiferaeindicae strain CFBP 9184]
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
ATGCAGATCGCCGAGGCCGCACAGGCGATCGGTATCCGCGATTTGCGGCAGTCGGCGTTGATGAAGGCTGCGCACGGGGT
GACCAACCTGGCGGAGATCAATCGTGTGACGAAGGACTAA
Domains
No domain identified.
3D structure
| Source | ID | Structure |
|---|
Similar proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|---|---|---|---|
| pilB | Acinetobacter baylyi ADP1 |
48.718 |
100 |
0.487 |
| pilB | Acinetobacter baumannii D1279779 |
46.154 |
100 |
0.462 |
| pilB | Legionella pneumophila strain ERS1305867 |
38.462 |
100 |
0.385 |
| pilB | Vibrio cholerae strain A1552 |
42.857 |
89.744 |
0.385 |