Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2087127..2087272 Replicon chromosome
Accession NZ_AP023306
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4567

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2087167..2087270 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2087127..2087272 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K5646_RS10155 2083553..2084251 - 699 WP_000944282.1 exodeoxyribonuclease X -
K5646_RS10160 2084275..2084931 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K5646_RS10165 2085039..2085269 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K5646_RS10170 2085407..2085781 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K5646_RS10175 2085782..2086657 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K5646_RS10180 2086674..2087027 + 354 WP_000722368.1 YebY family protein -
- 2087127..2087272 - 146 - - Antitoxin
- 2087167..2087270 + 104 - - Toxin
K5646_RS10185 2087401..2088324 - 924 Protein_2001 tyrosine-type recombinase/integrase -
K5646_RS24765 2088588..2089049 - 462 Protein_2002 DNA breaking-rejoining protein -
K5646_RS10195 2089038..2089229 + 192 Protein_2003 glycoside hydrolase family 19 protein -
K5646_RS10200 2089283..2089816 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K5646_RS10205 2090073..2090240 - 168 WP_000789530.1 lytic enzyme -
K5646_RS10210 2090305..2090493 - 189 WP_001521334.1 hypothetical protein -
K5646_RS10215 2090548..2090808 + 261 Protein_2007 DUF1441 family protein -
K5646_RS10220 2091023..2091367 + 345 Protein_2008 macro domain-containing protein -
K5646_RS10225 2091377..2091847 + 471 Protein_2009 tail fiber assembly protein -
K5646_RS10230 2091944..2092144 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2065259..2119783 54524


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T37421 NZ_AP023306:2087167-2087270 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT37421 NZ_AP023306:c2087272-2087127 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References