Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2144830..2144975 Replicon chromosome
Accession NZ_AP023303
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4526

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2144870..2144973 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2144830..2144975 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K5618_RS10505 2141256..2141954 - 699 WP_000944282.1 exodeoxyribonuclease X -
K5618_RS10510 2141978..2142634 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K5618_RS10515 2142742..2142972 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K5618_RS10520 2143110..2143484 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K5618_RS10525 2143485..2144360 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K5618_RS10530 2144377..2144730 + 354 WP_000722368.1 YebY family protein -
- 2144830..2144975 - 146 - - Antitoxin
- 2144870..2144973 + 104 - - Toxin
K5618_RS10535 2145104..2146027 - 924 Protein_2077 tyrosine-type recombinase/integrase -
K5618_RS24650 2146291..2146752 - 462 Protein_2078 DNA breaking-rejoining protein -
K5618_RS10545 2146741..2146932 + 192 Protein_2079 glycoside hydrolase family 19 protein -
K5618_RS10550 2146986..2147519 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K5618_RS10555 2147776..2147943 - 168 WP_000789530.1 lytic enzyme -
K5618_RS10560 2148008..2148196 - 189 WP_001521334.1 hypothetical protein -
K5618_RS10565 2148251..2148511 + 261 Protein_2083 DUF1441 family protein -
K5618_RS10570 2148726..2149070 + 345 Protein_2084 macro domain-containing protein -
K5618_RS10575 2149080..2149550 + 471 Protein_2085 tail fiber assembly protein -
K5618_RS10580 2149647..2149847 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2122962..2177487 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T37375 NZ_AP023303:2144870-2144973 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT37375 NZ_AP023303:c2144975-2144830 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References