Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2144830..2144975 | Replicon | chromosome |
| Accession | NZ_AP023303 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4526 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2144870..2144973 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2144830..2144975 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5618_RS10505 | 2141256..2141954 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5618_RS10510 | 2141978..2142634 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5618_RS10515 | 2142742..2142972 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5618_RS10520 | 2143110..2143484 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5618_RS10525 | 2143485..2144360 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5618_RS10530 | 2144377..2144730 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2144830..2144975 | - | 146 | - | - | Antitoxin |
| - | 2144870..2144973 | + | 104 | - | - | Toxin |
| K5618_RS10535 | 2145104..2146027 | - | 924 | Protein_2077 | tyrosine-type recombinase/integrase | - |
| K5618_RS24650 | 2146291..2146752 | - | 462 | Protein_2078 | DNA breaking-rejoining protein | - |
| K5618_RS10545 | 2146741..2146932 | + | 192 | Protein_2079 | glycoside hydrolase family 19 protein | - |
| K5618_RS10550 | 2146986..2147519 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5618_RS10555 | 2147776..2147943 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5618_RS10560 | 2148008..2148196 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5618_RS10565 | 2148251..2148511 | + | 261 | Protein_2083 | DUF1441 family protein | - |
| K5618_RS10570 | 2148726..2149070 | + | 345 | Protein_2084 | macro domain-containing protein | - |
| K5618_RS10575 | 2149080..2149550 | + | 471 | Protein_2085 | tail fiber assembly protein | - |
| K5618_RS10580 | 2149647..2149847 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2122962..2177487 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37375 NZ_AP023303:2144870-2144973 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37375 NZ_AP023303:c2144975-2144830 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG