Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2087129..2087274 | Replicon | chromosome |
| Accession | NZ_AP023300 | ||
| Organism | Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4445 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2087169..2087272 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2087129..2087274 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| K5630_RS10155 | 2083555..2084253 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| K5630_RS10160 | 2084277..2084933 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| K5630_RS10165 | 2085041..2085271 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| K5630_RS10170 | 2085409..2085783 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| K5630_RS10175 | 2085784..2086659 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| K5630_RS10180 | 2086676..2087029 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2087129..2087274 | - | 146 | - | - | Antitoxin |
| - | 2087169..2087272 | + | 104 | - | - | Toxin |
| K5630_RS10185 | 2087403..2088326 | - | 924 | Protein_2002 | tyrosine-type recombinase/integrase | - |
| K5630_RS24770 | 2088590..2089051 | - | 462 | Protein_2003 | DNA breaking-rejoining protein | - |
| K5630_RS10195 | 2089040..2089231 | + | 192 | Protein_2004 | glycoside hydrolase family 19 protein | - |
| K5630_RS10200 | 2089285..2089818 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| K5630_RS10205 | 2090075..2090242 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| K5630_RS10210 | 2090307..2090495 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| K5630_RS10215 | 2090550..2090810 | + | 261 | Protein_2008 | DUF1441 family protein | - |
| K5630_RS10220 | 2091025..2091369 | + | 345 | Protein_2009 | macro domain-containing protein | - |
| K5630_RS10225 | 2091379..2091849 | + | 471 | Protein_2010 | tail fiber assembly protein | - |
| K5630_RS10230 | 2091946..2092146 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2065261..2119785 | 54524 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T37344 NZ_AP023300:2087169-2087272 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT37344 NZ_AP023300:c2087274-2087129 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG