Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2087129..2087274 Replicon chromosome
Accession NZ_AP023300
Organism Salmonella enterica subsp. enterica serovar 4[5]12:i:- strain L-4445

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2087169..2087272 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2087129..2087274 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
K5630_RS10155 2083555..2084253 - 699 WP_000944282.1 exodeoxyribonuclease X -
K5630_RS10160 2084277..2084933 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
K5630_RS10165 2085041..2085271 - 231 WP_000856224.1 DNA polymerase III subunit theta -
K5630_RS10170 2085409..2085783 + 375 WP_000168393.1 CopC domain-containing protein YobA -
K5630_RS10175 2085784..2086659 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
K5630_RS10180 2086676..2087029 + 354 WP_000722368.1 YebY family protein -
- 2087129..2087274 - 146 - - Antitoxin
- 2087169..2087272 + 104 - - Toxin
K5630_RS10185 2087403..2088326 - 924 Protein_2002 tyrosine-type recombinase/integrase -
K5630_RS24770 2088590..2089051 - 462 Protein_2003 DNA breaking-rejoining protein -
K5630_RS10195 2089040..2089231 + 192 Protein_2004 glycoside hydrolase family 19 protein -
K5630_RS10200 2089285..2089818 + 534 WP_001050882.1 DUF2514 domain-containing protein -
K5630_RS10205 2090075..2090242 - 168 WP_000789530.1 lytic enzyme -
K5630_RS10210 2090307..2090495 - 189 WP_001521334.1 hypothetical protein -
K5630_RS10215 2090550..2090810 + 261 Protein_2008 DUF1441 family protein -
K5630_RS10220 2091025..2091369 + 345 Protein_2009 macro domain-containing protein -
K5630_RS10225 2091379..2091849 + 471 Protein_2010 tail fiber assembly protein -
K5630_RS10230 2091946..2092146 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2065261..2119785 54524


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T37344 NZ_AP023300:2087169-2087272 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT37344 NZ_AP023300:c2087274-2087129 [Salmonella enterica subsp. enterica serovar 4,[5],12:i:-]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References