Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 335462..335607 | Replicon | chromosome |
Accession | NZ_OU015340 | ||
Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00027944 isolate AUSMDU00027944 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 335502..335605 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 335462..335607 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KKR00_RS01855 | 331888..332586 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
KKR00_RS01860 | 332610..333266 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
KKR00_RS01865 | 333374..333604 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
KKR00_RS01870 | 333742..334116 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
KKR00_RS01875 | 334117..334992 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
KKR00_RS01880 | 335009..335362 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 335462..335607 | - | 146 | - | - | Antitoxin |
- | 335502..335605 | + | 104 | - | - | Toxin |
KKR00_RS01885 | 335736..336659 | - | 924 | Protein_375 | tyrosine-type recombinase/integrase | - |
KKR00_RS26395 | 336923..337384 | - | 462 | Protein_376 | DNA breaking-rejoining protein | - |
KKR00_RS01895 | 337373..337564 | + | 192 | Protein_377 | glycoside hydrolase family 19 protein | - |
KKR00_RS01900 | 337618..338151 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
KKR00_RS01905 | 338408..338575 | - | 168 | WP_000789530.1 | lytic enzyme | - |
KKR00_RS01910 | 338640..338828 | - | 189 | WP_001521334.1 | hypothetical protein | - |
KKR00_RS01915 | 338883..339143 | + | 261 | Protein_381 | DUF1441 family protein | - |
KKR00_RS01920 | 339358..339702 | + | 345 | Protein_382 | macro domain-containing protein | - |
KKR00_RS01925 | 339712..340182 | + | 471 | Protein_383 | tail fiber assembly protein | - |
KKR00_RS01930 | 340279..340479 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 315465..368119 | 52654 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T294632 NZ_OU015340:335502-335605 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT294632 NZ_OU015340:c335607-335462 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG