Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 335461..335606 Replicon chromosome
Accession NZ_OU015323
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00004549 isolate AUSMDU00004549

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 335501..335604 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 335461..335606 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
KKQ99_RS01865 331887..332585 - 699 WP_000944282.1 exodeoxyribonuclease X -
KKQ99_RS01870 332609..333265 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
KKQ99_RS01875 333373..333603 - 231 WP_000856224.1 DNA polymerase III subunit theta -
KKQ99_RS01880 333741..334115 + 375 WP_000168393.1 CopC domain-containing protein YobA -
KKQ99_RS01885 334116..334991 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
KKQ99_RS01890 335008..335361 + 354 WP_000722368.1 YebY family protein -
- 335461..335606 - 146 - - Antitoxin
- 335501..335604 + 104 - - Toxin
KKQ99_RS01895 335735..336658 - 924 Protein_378 tyrosine-type recombinase/integrase -
KKQ99_RS26375 336922..337383 - 462 Protein_379 DNA breaking-rejoining protein -
KKQ99_RS01905 337372..337563 + 192 Protein_380 glycoside hydrolase family 19 protein -
KKQ99_RS01910 337617..338150 + 534 WP_001050882.1 DUF2514 domain-containing protein -
KKQ99_RS01915 338407..338574 - 168 WP_000789530.1 lytic enzyme -
KKQ99_RS01920 338639..338827 - 189 WP_001521334.1 hypothetical protein -
KKQ99_RS01925 338882..339142 + 261 Protein_384 DUF1441 family protein -
KKQ99_RS01930 339357..339701 + 345 Protein_385 macro domain-containing protein -
KKQ99_RS01935 339711..340181 + 471 Protein_386 tail fiber assembly protein -
KKQ99_RS01940 340278..340478 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 315464..368118 52654


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T294610 NZ_OU015323:335501-335604 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT294610 NZ_OU015323:c335606-335461 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References