Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 335461..335606 | Replicon | chromosome |
| Accession | NZ_OU015323 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain AUSMDU00004549 isolate AUSMDU00004549 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 335501..335604 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 335461..335606 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KKQ99_RS01865 | 331887..332585 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| KKQ99_RS01870 | 332609..333265 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| KKQ99_RS01875 | 333373..333603 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KKQ99_RS01880 | 333741..334115 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| KKQ99_RS01885 | 334116..334991 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| KKQ99_RS01890 | 335008..335361 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 335461..335606 | - | 146 | - | - | Antitoxin |
| - | 335501..335604 | + | 104 | - | - | Toxin |
| KKQ99_RS01895 | 335735..336658 | - | 924 | Protein_378 | tyrosine-type recombinase/integrase | - |
| KKQ99_RS26375 | 336922..337383 | - | 462 | Protein_379 | DNA breaking-rejoining protein | - |
| KKQ99_RS01905 | 337372..337563 | + | 192 | Protein_380 | glycoside hydrolase family 19 protein | - |
| KKQ99_RS01910 | 337617..338150 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| KKQ99_RS01915 | 338407..338574 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| KKQ99_RS01920 | 338639..338827 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| KKQ99_RS01925 | 338882..339142 | + | 261 | Protein_384 | DUF1441 family protein | - |
| KKQ99_RS01930 | 339357..339701 | + | 345 | Protein_385 | macro domain-containing protein | - |
| KKQ99_RS01935 | 339711..340181 | + | 471 | Protein_386 | tail fiber assembly protein | - |
| KKQ99_RS01940 | 340278..340478 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 315464..368118 | 52654 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T294610 NZ_OU015323:335501-335604 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT294610 NZ_OU015323:c335606-335461 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG