Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1956822..1956965 Replicon chromosome
Accession NZ_CP117696
Organism Salmonella enterica subsp. enterica serovar London strain F1

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1956861..1956963 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1956822..1956965 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
PTQ22_RS09320 1953246..1953944 - 699 WP_023255939.1 exodeoxyribonuclease X -
PTQ22_RS09325 1953968..1954624 - 657 WP_023245437.1 carbon-nitrogen hydrolase family protein -
PTQ22_RS09330 1954732..1954962 - 231 WP_000856224.1 DNA polymerase III subunit theta -
PTQ22_RS09335 1955100..1955474 + 375 WP_000168393.1 CopC domain-containing protein YobA -
PTQ22_RS09340 1955475..1956350 + 876 WP_000979694.1 copper homeostasis membrane protein CopD -
PTQ22_RS09345 1956367..1956720 + 354 WP_000722368.1 YebY family protein -
- 1956822..1956965 - 144 - - Antitoxin
- 1956861..1956963 + 103 - - Toxin
PTQ22_RS09350 1957103..1958182 - 1080 WP_058107134.1 phage integrase Arm DNA-binding domain-containing protein -
PTQ22_RS09355 1958215..1959366 - 1152 Protein_1827 PD-(D/E)XK nuclease-like domain-containing protein -
PTQ22_RS09360 1959355..1959546 + 192 Protein_1828 glycoside hydrolase family 19 protein -
PTQ22_RS09365 1959600..1960133 + 534 WP_023256014.1 DUF2514 domain-containing protein -
PTQ22_RS09370 1960390..1960557 - 168 WP_000789530.1 lytic enzyme -
PTQ22_RS09375 1960622..1960810 - 189 WP_001034748.1 hypothetical protein -
PTQ22_RS09380 1960865..1961125 + 261 Protein_1832 DUF1441 family protein -
PTQ22_RS09385 1961127..1961342 + 216 Protein_1833 shikimate transporter -
PTQ22_RS09390 1961352..1961639 + 288 Protein_1834 macro domain-containing protein -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
- inside Prophage - sopE2 1951158..1977134 25976
inside Prophage - sopE2 1951158..1990059 38901


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 103 bp

>T272044 NZ_CP117696:1956861-1956963 [Salmonella enterica subsp. enterica serovar London]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT272044 NZ_CP117696:c1956965-1956822 [Salmonella enterica subsp. enterica serovar London]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References