Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2104990..2105135 | Replicon | chromosome |
| Accession | NZ_CP110201 | ||
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium strain 1104-65 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2105030..2105133 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2104990..2105135 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OCK73_RS10210 | 2101416..2102114 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| OCK73_RS10215 | 2102138..2102794 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| OCK73_RS10220 | 2102902..2103132 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| OCK73_RS10225 | 2103270..2103644 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| OCK73_RS10230 | 2103645..2104520 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| OCK73_RS10235 | 2104537..2104890 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2104990..2105135 | - | 146 | - | - | Antitoxin |
| - | 2105030..2105133 | + | 104 | - | - | Toxin |
| OCK73_RS10240 | 2105264..2106187 | - | 924 | Protein_2002 | tyrosine-type recombinase/integrase | - |
| OCK73_RS10245 | 2106451..2106912 | - | 462 | Protein_2003 | DNA breaking-rejoining protein | - |
| OCK73_RS10250 | 2106901..2107092 | + | 192 | Protein_2004 | glycoside hydrolase family 19 protein | - |
| OCK73_RS10255 | 2107146..2107679 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| OCK73_RS10260 | 2107936..2108103 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| OCK73_RS10265 | 2108168..2108356 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| OCK73_RS10270 | 2108411..2108671 | + | 261 | Protein_2008 | DUF1441 family protein | - |
| OCK73_RS10275 | 2108886..2109230 | + | 345 | Protein_2009 | macro domain-containing protein | - |
| OCK73_RS10280 | 2109240..2109710 | + | 471 | Protein_2010 | tail fiber assembly protein | - |
| OCK73_RS10285 | 2109807..2110007 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2083122..2137647 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T263416 NZ_CP110201:2105030-2105133 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT263416 NZ_CP110201:c2105135-2104990 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG