Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1978759..1978904 | Replicon | chromosome |
| Accession | NZ_CP100702 | ||
| Organism | Salmonella enterica subsp. enterica serovar Thompson strain R18.0872 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1978799..1978902 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1978759..1978904 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NL734_RS09590 | 1975185..1975883 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NL734_RS09595 | 1975907..1976563 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| NL734_RS09600 | 1976671..1976901 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NL734_RS09605 | 1977039..1977413 | + | 375 | WP_022544651.1 | CopC domain-containing protein YobA | - |
| NL734_RS09610 | 1977414..1978289 | + | 876 | WP_017466156.1 | copper homeostasis membrane protein CopD | - |
| NL734_RS09615 | 1978306..1978659 | + | 354 | WP_017466155.1 | YebY family protein | - |
| - | 1978759..1978904 | - | 146 | - | - | Antitoxin |
| - | 1978799..1978902 | + | 104 | - | - | Toxin |
| NL734_RS09620 | 1979042..1980121 | - | 1080 | WP_017466154.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| NL734_RS09625 | 1980154..1981305 | - | 1152 | Protein_1876 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| NL734_RS09630 | 1981294..1981485 | + | 192 | Protein_1877 | glycoside hydrolase family 19 protein | - |
| NL734_RS09635 | 1981539..1982072 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| NL734_RS09640 | 1982329..1982496 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| NL734_RS09645 | 1982804..1983064 | + | 261 | Protein_1880 | DUF1441 family protein | - |
| NL734_RS09650 | 1983066..1983281 | + | 216 | Protein_1881 | shikimate transporter | - |
| NL734_RS09655 | 1983279..1983623 | + | 345 | Protein_1882 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1973097..2011795 | 38698 | ||
| - | inside | Prophage | - | sopE2 | 1956881..2011795 | 54914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T251111 NZ_CP100702:1978799-1978902 [Salmonella enterica subsp. enterica serovar Thompson]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT251111 NZ_CP100702:c1978904-1978759 [Salmonella enterica subsp. enterica serovar Thompson]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
