Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2085513..2085658 Replicon chromosome
Accession NZ_CP098438
Organism Salmonella enterica subsp. enterica serovar Typhimurium strain ATOMSal-L6

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2085553..2085656 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2085513..2085658 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
M9193_RS09990 2081939..2082637 - 699 WP_000944282.1 exodeoxyribonuclease X -
M9193_RS09995 2082661..2083317 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
M9193_RS10000 2083425..2083655 - 231 WP_000856224.1 DNA polymerase III subunit theta -
M9193_RS10005 2083793..2084167 + 375 WP_000168393.1 CopC domain-containing protein YobA -
M9193_RS10010 2084168..2085043 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
M9193_RS10015 2085060..2085413 + 354 WP_000722368.1 YebY family protein -
- 2085513..2085658 - 146 - - Antitoxin
- 2085553..2085656 + 104 - - Toxin
M9193_RS10020 2085787..2086710 - 924 Protein_1959 tyrosine-type recombinase/integrase -
M9193_RS10025 2086974..2087435 - 462 Protein_1960 DNA breaking-rejoining protein -
M9193_RS10030 2087424..2087615 + 192 Protein_1961 glycoside hydrolase family 19 protein -
M9193_RS10035 2087669..2088202 + 534 WP_001050882.1 DUF2514 domain-containing protein -
M9193_RS10040 2088459..2088626 - 168 WP_000789530.1 lytic enzyme -
M9193_RS10045 2088691..2088879 - 189 WP_001521334.1 hypothetical protein -
M9193_RS10050 2088934..2089194 + 261 Protein_1965 DUF1441 family protein -
M9193_RS10055 2089409..2089753 + 345 Protein_1966 macro domain-containing protein -
M9193_RS10060 2089763..2090233 + 471 Protein_1967 tail fiber assembly protein -
M9193_RS10065 2090330..2090530 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2065516..2118162 52646


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T247622 NZ_CP098438:2085553-2085656 [Salmonella enterica subsp. enterica serovar Typhimurium]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT247622 NZ_CP098438:c2085658-2085513 [Salmonella enterica subsp. enterica serovar Typhimurium]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References