Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 1983266..1983409 Replicon chromosome
Accession NZ_CP093373
Organism Salmonella enterica subsp. enterica serovar Infantis strain 423_13

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 1983304..1983407 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 1983266..1983409 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
MNU28_RS09605 1979690..1980388 - 699 WP_000944278.1 exodeoxyribonuclease X -
MNU28_RS09610 1980412..1981068 - 657 WP_000100256.1 nitrilase-related carbon-nitrogen hydrolase -
MNU28_RS09615 1981176..1981406 - 231 WP_000856224.1 DNA polymerase III subunit theta -
MNU28_RS09620 1981544..1981918 + 375 WP_000168393.1 CopC domain-containing protein YobA -
MNU28_RS09625 1981919..1982794 + 876 WP_000979694.1 copper homeostasis membrane protein CopD -
MNU28_RS09630 1982811..1983164 + 354 WP_000722368.1 YebY family protein -
- 1983266..1983409 - 144 - - Antitoxin
- 1983304..1983407 + 104 - - Toxin
MNU28_RS09635 1983567..1984460 - 894 Protein_1874 tyrosine-type recombinase/integrase -
MNU28_RS09640 1984724..1985185 - 462 Protein_1875 DNA breaking-rejoining protein -
MNU28_RS09645 1985174..1985365 + 192 Protein_1876 glycoside hydrolase family 19 protein -
MNU28_RS09650 1985419..1985952 + 534 WP_001050883.1 DUF2514 domain-containing protein -
MNU28_RS09655 1986209..1986376 - 168 WP_000789529.1 lytic enzyme -
MNU28_RS09660 1986684..1986944 + 261 Protein_1879 DUF1441 family protein -
MNU28_RS09665 1986946..1987161 + 216 Protein_1880 shikimate transporter -
MNU28_RS09670 1987171..1987458 + 288 Protein_1881 macro domain-containing protein -
MNU28_RS09675 1987471..1987982 + 512 Protein_1882 tail fiber assembly protein -
MNU28_RS09680 1988079..1988279 - 201 Protein_1883 phage virulence factor PagK family protein -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 1977604..2015913 38309


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T238304 NZ_CP093373:1983304-1983407 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 144 bp

>AT238304 NZ_CP093373:c1983409-1983266 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References