Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1983266..1983409 | Replicon | chromosome |
| Accession | NZ_CP093373 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain 423_13 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1983304..1983407 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1983266..1983409 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MNU28_RS09605 | 1979690..1980388 | - | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
| MNU28_RS09610 | 1980412..1981068 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| MNU28_RS09615 | 1981176..1981406 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MNU28_RS09620 | 1981544..1981918 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MNU28_RS09625 | 1981919..1982794 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MNU28_RS09630 | 1982811..1983164 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1983266..1983409 | - | 144 | - | - | Antitoxin |
| - | 1983304..1983407 | + | 104 | - | - | Toxin |
| MNU28_RS09635 | 1983567..1984460 | - | 894 | Protein_1874 | tyrosine-type recombinase/integrase | - |
| MNU28_RS09640 | 1984724..1985185 | - | 462 | Protein_1875 | DNA breaking-rejoining protein | - |
| MNU28_RS09645 | 1985174..1985365 | + | 192 | Protein_1876 | glycoside hydrolase family 19 protein | - |
| MNU28_RS09650 | 1985419..1985952 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| MNU28_RS09655 | 1986209..1986376 | - | 168 | WP_000789529.1 | lytic enzyme | - |
| MNU28_RS09660 | 1986684..1986944 | + | 261 | Protein_1879 | DUF1441 family protein | - |
| MNU28_RS09665 | 1986946..1987161 | + | 216 | Protein_1880 | shikimate transporter | - |
| MNU28_RS09670 | 1987171..1987458 | + | 288 | Protein_1881 | macro domain-containing protein | - |
| MNU28_RS09675 | 1987471..1987982 | + | 512 | Protein_1882 | tail fiber assembly protein | - |
| MNU28_RS09680 | 1988079..1988279 | - | 201 | Protein_1883 | phage virulence factor PagK family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 1977604..2015913 | 38309 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238304 NZ_CP093373:1983304-1983407 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238304 NZ_CP093373:c1983409-1983266 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
