Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2051741..2051886 Replicon chromosome
Accession NZ_CP092690
Organism Salmonella enterica subsp. enterica serovar Thompson strain MFDS1011716

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2051781..2051884 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2051741..2051886 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
MKV11_RS10035 2048167..2048865 - 699 WP_000944282.1 exodeoxyribonuclease X -
MKV11_RS10040 2048889..2049545 - 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
MKV11_RS10045 2049653..2049883 - 231 WP_000856224.1 DNA polymerase III subunit theta -
MKV11_RS10050 2050021..2050395 + 375 WP_022544651.1 CopC domain-containing protein YobA -
MKV11_RS10055 2050396..2051271 + 876 WP_017466156.1 copper homeostasis membrane protein CopD -
MKV11_RS10060 2051288..2051641 + 354 WP_017466155.1 YebY family protein -
- 2051741..2051886 - 146 - - Antitoxin
- 2051781..2051884 + 104 - - Toxin
MKV11_RS10065 2052024..2053103 - 1080 WP_017466154.1 phage integrase Arm DNA-binding domain-containing protein -
MKV11_RS10070 2053136..2054287 - 1152 Protein_1967 PD-(D/E)XK nuclease-like domain-containing protein -
MKV11_RS10075 2054276..2054467 + 192 Protein_1968 glycoside hydrolase family 19 protein -
MKV11_RS10080 2054521..2055054 + 534 WP_001050883.1 DUF2514 domain-containing protein -
MKV11_RS10085 2055311..2055478 - 168 WP_000789530.1 lytic enzyme -
MKV11_RS10090 2055786..2056046 + 261 Protein_1971 DUF1441 family protein -
MKV11_RS10095 2056048..2056263 + 216 Protein_1972 shikimate transporter -
MKV11_RS10100 2056261..2056605 + 345 Protein_1973 macro domain-containing protein -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2046079..2084777 38698


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T236946 NZ_CP092690:2051781-2051884 [Salmonella enterica subsp. enterica serovar Thompson]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT236946 NZ_CP092690:c2051886-2051741 [Salmonella enterica subsp. enterica serovar Thompson]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References