Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2051639..2051784 | Replicon | chromosome |
| Accession | NZ_CP092627 | ||
| Organism | Salmonella enterica subsp. enterica serovar Thompson strain MFDS1011657 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2051679..2051782 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2051639..2051784 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MJ899_RS10035 | 2048065..2048763 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| MJ899_RS10040 | 2048787..2049443 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| MJ899_RS10045 | 2049551..2049781 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MJ899_RS10050 | 2049919..2050293 | + | 375 | WP_022544651.1 | CopC domain-containing protein YobA | - |
| MJ899_RS10055 | 2050294..2051169 | + | 876 | WP_017466156.1 | copper homeostasis membrane protein CopD | - |
| MJ899_RS10060 | 2051186..2051539 | + | 354 | WP_017466155.1 | YebY family protein | - |
| - | 2051639..2051784 | - | 146 | - | - | Antitoxin |
| - | 2051679..2051782 | + | 104 | - | - | Toxin |
| MJ899_RS10065 | 2051922..2053001 | - | 1080 | WP_017466154.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| MJ899_RS10070 | 2053034..2054185 | - | 1152 | Protein_1967 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| MJ899_RS10075 | 2054174..2054365 | + | 192 | Protein_1968 | glycoside hydrolase family 19 protein | - |
| MJ899_RS10080 | 2054419..2054952 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| MJ899_RS10085 | 2055209..2055376 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| MJ899_RS10090 | 2055684..2055944 | + | 261 | Protein_1971 | DUF1441 family protein | - |
| MJ899_RS10095 | 2055946..2056161 | + | 216 | Protein_1972 | shikimate transporter | - |
| MJ899_RS10100 | 2056159..2056503 | + | 345 | Protein_1973 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2045977..2084675 | 38698 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T236737 NZ_CP092627:2051679-2051782 [Salmonella enterica subsp. enterica serovar Thompson]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT236737 NZ_CP092627:c2051784-2051639 [Salmonella enterica subsp. enterica serovar Thompson]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG