Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2051639..2051784 Replicon chromosome
Accession NZ_CP092627
Organism Salmonella enterica subsp. enterica serovar Thompson strain MFDS1011657

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2051679..2051782 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2051639..2051784 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
MJ899_RS10035 2048065..2048763 - 699 WP_000944282.1 exodeoxyribonuclease X -
MJ899_RS10040 2048787..2049443 - 657 WP_000100249.1 carbon-nitrogen hydrolase family protein -
MJ899_RS10045 2049551..2049781 - 231 WP_000856224.1 DNA polymerase III subunit theta -
MJ899_RS10050 2049919..2050293 + 375 WP_022544651.1 CopC domain-containing protein YobA -
MJ899_RS10055 2050294..2051169 + 876 WP_017466156.1 copper homeostasis membrane protein CopD -
MJ899_RS10060 2051186..2051539 + 354 WP_017466155.1 YebY family protein -
- 2051639..2051784 - 146 - - Antitoxin
- 2051679..2051782 + 104 - - Toxin
MJ899_RS10065 2051922..2053001 - 1080 WP_017466154.1 phage integrase Arm DNA-binding domain-containing protein -
MJ899_RS10070 2053034..2054185 - 1152 Protein_1967 PD-(D/E)XK nuclease-like domain-containing protein -
MJ899_RS10075 2054174..2054365 + 192 Protein_1968 glycoside hydrolase family 19 protein -
MJ899_RS10080 2054419..2054952 + 534 WP_001050883.1 DUF2514 domain-containing protein -
MJ899_RS10085 2055209..2055376 - 168 WP_000789530.1 lytic enzyme -
MJ899_RS10090 2055684..2055944 + 261 Protein_1971 DUF1441 family protein -
MJ899_RS10095 2055946..2056161 + 216 Protein_1972 shikimate transporter -
MJ899_RS10100 2056159..2056503 + 345 Protein_1973 macro domain-containing protein -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2045977..2084675 38698


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T236737 NZ_CP092627:2051679-2051782 [Salmonella enterica subsp. enterica serovar Thompson]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT236737 NZ_CP092627:c2051784-2051639 [Salmonella enterica subsp. enterica serovar Thompson]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References