Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2051720..2051865 | Replicon | chromosome |
Accession | NZ_CP092510 | ||
Organism | Salmonella enterica subsp. enterica serovar Thompson |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2051760..2051863 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2051720..2051865 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MKE90_RS10035 | 2048146..2048844 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
MKE90_RS10040 | 2048868..2049524 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
MKE90_RS10045 | 2049632..2049862 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
MKE90_RS10050 | 2050000..2050374 | + | 375 | WP_022544651.1 | CopC domain-containing protein YobA | - |
MKE90_RS10055 | 2050375..2051250 | + | 876 | WP_017466156.1 | copper homeostasis membrane protein CopD | - |
MKE90_RS10060 | 2051267..2051620 | + | 354 | WP_017466155.1 | YebY family protein | - |
- | 2051720..2051865 | - | 146 | - | - | Antitoxin |
- | 2051760..2051863 | + | 104 | - | - | Toxin |
MKE90_RS10065 | 2052003..2053082 | - | 1080 | WP_017466154.1 | phage integrase Arm DNA-binding domain-containing protein | - |
MKE90_RS10070 | 2053115..2054266 | - | 1152 | Protein_1967 | PD-(D/E)XK nuclease-like domain-containing protein | - |
MKE90_RS10075 | 2054255..2054446 | + | 192 | Protein_1968 | glycoside hydrolase family 19 protein | - |
MKE90_RS10080 | 2054500..2055033 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
MKE90_RS10085 | 2055290..2055457 | - | 168 | WP_000789530.1 | lytic enzyme | - |
MKE90_RS10090 | 2055765..2056025 | + | 261 | Protein_1971 | DUF1441 family protein | - |
MKE90_RS10095 | 2056027..2056242 | + | 216 | Protein_1972 | shikimate transporter | - |
MKE90_RS10100 | 2056240..2056584 | + | 345 | Protein_1973 | macro domain-containing protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
inside | Prophage | - | sopE2 | 2046058..2084756 | 38698 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T236335 NZ_CP092510:2051760-2051863 [Salmonella enterica subsp. enterica serovar Thompson]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT236335 NZ_CP092510:c2051865-2051720 [Salmonella enterica subsp. enterica serovar Thompson]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG