Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2107737..2107882 | Replicon | chromosome |
| Accession | NZ_CP091569 | ||
| Organism | Salmonella enterica strain 131 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2107777..2107880 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2107737..2107882 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| INN75_RS10310 | 2104163..2104861 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| INN75_RS10315 | 2104885..2105541 | - | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| INN75_RS10320 | 2105649..2105879 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| INN75_RS10325 | 2106017..2106391 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| INN75_RS10330 | 2106392..2107267 | + | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| INN75_RS10335 | 2107284..2107637 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2107737..2107882 | - | 146 | - | - | Antitoxin |
| - | 2107777..2107880 | + | 104 | - | - | Toxin |
| INN75_RS10340 | 2108011..2108934 | - | 924 | Protein_2026 | tyrosine-type recombinase/integrase | - |
| INN75_RS10345 | 2109198..2109659 | - | 462 | Protein_2027 | DNA breaking-rejoining protein | - |
| INN75_RS10350 | 2109648..2109839 | + | 192 | Protein_2028 | glycoside hydrolase family 19 protein | - |
| INN75_RS10355 | 2109893..2110426 | + | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| INN75_RS10360 | 2110683..2110850 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| INN75_RS10365 | 2110915..2111103 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| INN75_RS10370 | 2111158..2111418 | + | 261 | Protein_2032 | DUF1441 family protein | - |
| INN75_RS10375 | 2111633..2111977 | + | 345 | Protein_2033 | macro domain-containing protein | - |
| INN75_RS10380 | 2111987..2112457 | + | 471 | Protein_2034 | tail fiber assembly protein | - |
| INN75_RS10385 | 2112554..2112754 | - | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| inside | Prophage | - | sopE2 | 2085869..2140394 | 54525 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233836 NZ_CP091569:2107777-2107880 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233836 NZ_CP091569:c2107882-2107737 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG