Detailed information of TA system    

insolicoBioinformatically predicted

Overview

TA module


Type VIII Classification (family/domain) SdsR-RyeA/-
Location 2107737..2107882 Replicon chromosome
Accession NZ_CP091569
Organism Salmonella enterica strain 131

Toxin (RNA)


Gene name SdsR
Locus tag -
Coordinates 2107777..2107880 (+)

Antitoxin (RNA)


Gene name RyeA
Locus tag -
Coordinates 2107737..2107882 (-)

Genomic Context

Locus tag Coordinates Strand Size (bp) Protein ID Product Description
INN75_RS10310 2104163..2104861 - 699 WP_000944282.1 exodeoxyribonuclease X -
INN75_RS10315 2104885..2105541 - 657 WP_000100258.1 carbon-nitrogen hydrolase family protein -
INN75_RS10320 2105649..2105879 - 231 WP_000856224.1 DNA polymerase III subunit theta -
INN75_RS10325 2106017..2106391 + 375 WP_000168393.1 CopC domain-containing protein YobA -
INN75_RS10330 2106392..2107267 + 876 WP_000979702.1 copper homeostasis membrane protein CopD -
INN75_RS10335 2107284..2107637 + 354 WP_000722368.1 YebY family protein -
- 2107737..2107882 - 146 - - Antitoxin
- 2107777..2107880 + 104 - - Toxin
INN75_RS10340 2108011..2108934 - 924 Protein_2026 tyrosine-type recombinase/integrase -
INN75_RS10345 2109198..2109659 - 462 Protein_2027 DNA breaking-rejoining protein -
INN75_RS10350 2109648..2109839 + 192 Protein_2028 glycoside hydrolase family 19 protein -
INN75_RS10355 2109893..2110426 + 534 WP_001050882.1 DUF2514 domain-containing protein -
INN75_RS10360 2110683..2110850 - 168 WP_000789530.1 lytic enzyme -
INN75_RS10365 2110915..2111103 - 189 WP_001521334.1 hypothetical protein -
INN75_RS10370 2111158..2111418 + 261 Protein_2032 DUF1441 family protein -
INN75_RS10375 2111633..2111977 + 345 Protein_2033 macro domain-containing protein -
INN75_RS10380 2111987..2112457 + 471 Protein_2034 tail fiber assembly protein -
INN75_RS10385 2112554..2112754 - 201 WP_010989029.1 PagK family vesicle-borne virulence factor -

Associated MGEs

MGE
detail		 Similar
MGEs		 Relative
position		 MGE Type Cargo ARG Virulence gene Coordinates Length (bp)
inside Prophage - sopE2 2085869..2140394 54525


Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.


Sequences

Toxin        


Download         Length: 104 bp

>T233836 NZ_CP091569:2107777-2107880 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT

Antitoxin


Download         Length: 146 bp

>AT233836 NZ_CP091569:c2107882-2107737 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG

Structures

Antitoxin

Download structure file

Antitoxin

Download structure file

References